Incidental Mutation 'R0919:Dbpht2'
ID82787
Institutional Source Beutler Lab
Gene Symbol Dbpht2
Ensembl Gene ENSMUSG00000029878
Gene NameDNA binding protein with his-thr domain
SynonymsSpot2
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R0919 (G1)
Quality Score139
Status Validated
Chromosome12
Chromosomal Location74297474-74300468 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 74299000 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072100
SMART Domains Protein: ENSMUSP00000071973
Gene: ENSMUSG00000029878

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221311
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Dbpht2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1349:Dbpht2 UTSW 12 74299062 exon noncoding transcript
R1639:Dbpht2 UTSW 12 74299158 exon noncoding transcript
R1813:Dbpht2 UTSW 12 74295850 unclassified noncoding transcript
R1976:Dbpht2 UTSW 12 74295861 unclassified noncoding transcript
R4451:Dbpht2 UTSW 12 74299032 exon noncoding transcript
R4541:Dbpht2 UTSW 12 74299160 exon noncoding transcript
R4650:Dbpht2 UTSW 12 74299159 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGAGACTCATGCAAGTATGCACAC -3'
(R):5'- CATGGCTGAATCCATCCACTCAGG -3'

Sequencing Primer
(F):5'- acacacaaacacacagacatac -3'
(R):5'- GGAACAATCTAGTCTTTCACTTAGGG -3'
Posted On2013-11-08