Incidental Mutation 'R0919:Txn2'
ID82792
Institutional Source Beutler Lab
Gene Symbol Txn2
Ensembl Gene ENSMUSG00000005354
Gene Namethioredoxin 2
SynonymsTrx2, 2510006J11Rik
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77915047-77929006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77927749 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000105370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005487] [ENSMUST00000100486] [ENSMUST00000109747] [ENSMUST00000109748] [ENSMUST00000174529]
Predicted Effect probably damaging
Transcript: ENSMUST00000005487
AA Change: D69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005487
Gene: ENSMUSG00000005354
AA Change: D69G

DomainStartEndE-ValueType
Pfam:Thioredoxin 61 164 7.8e-31 PFAM
Pfam:Thioredoxin_7 72 141 5.1e-9 PFAM
Pfam:Thioredoxin_2 74 161 2.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100486
AA Change: D69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098055
Gene: ENSMUSG00000005354
AA Change: D69G

DomainStartEndE-ValueType
PDB:1W89|F 60 88 9e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000109747
AA Change: D69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105369
Gene: ENSMUSG00000005354
AA Change: D69G

DomainStartEndE-ValueType
Pfam:Thioredoxin 61 138 3.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109748
AA Change: D69G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105370
Gene: ENSMUSG00000005354
AA Change: D69G

DomainStartEndE-ValueType
Pfam:Thioredoxin 61 164 2.6e-30 PFAM
Pfam:Thioredoxin_2 74 161 1.7e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173631
AA Change: D32G
SMART Domains Protein: ENSMUSP00000134682
Gene: ENSMUSG00000005354
AA Change: D32G

DomainStartEndE-ValueType
Pfam:Thioredoxin 25 128 8.1e-31 PFAM
Pfam:Thioredoxin_2 38 125 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174468
SMART Domains Protein: ENSMUSP00000133548
Gene: ENSMUSG00000005354

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 57 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174529
SMART Domains Protein: ENSMUSP00000133605
Gene: ENSMUSG00000005354

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 62 5.6e-19 PFAM
Pfam:Thioredoxin_7 3 80 1.5e-8 PFAM
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial member of the thioredoxin family, a group of small multifunctional redox-active proteins. The encoded protein may play important roles in the regulation of the mitochondrial membrane potential and in protection against oxidant-induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene exhibit exencephaly and embyronic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Txn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0611:Txn2 UTSW 15 77927717 missense probably damaging 1.00
R2504:Txn2 UTSW 15 77926670 intron probably benign
R3700:Txn2 UTSW 15 77927776 missense possibly damaging 0.69
R4515:Txn2 UTSW 15 77915443 unclassified probably null
R5897:Txn2 UTSW 15 77924526 missense probably benign 0.43
R6879:Txn2 UTSW 15 77919722 intron probably benign
R7101:Txn2 UTSW 15 77926678 missense unknown
R7215:Txn2 UTSW 15 77927686 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGGCACAGGGTCTCAAAAGTCTTC -3'
(R):5'- TGACTTCCTATTGCATGGCCCCAG -3'

Sequencing Primer
(F):5'- CAGGGTCTCAAAAGTCTTCATAATG -3'
(R):5'- TTGCTCCCACAGATGGC -3'
Posted On2013-11-08