Incidental Mutation 'R0919:Cyp2c38'
ID82804
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39389556-39463075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39404669 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 318 (D318A)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
Predicted Effect probably benign
Transcript: ENSMUST00000035488
AA Change: D318A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: D318A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7625:Cyp2c38 UTSW 19 39462924 missense possibly damaging 0.78
R7666:Cyp2c38 UTSW 19 39438242 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGACCAGCATTTGATTGCTTTACCTACA -3'
(R):5'- tctgggctaataAGGGGCAAAGAATCT -3'

Sequencing Primer
(F):5'- GATTGCTTTACCTACAGTCAGAGTC -3'
(R):5'- GGACTCAAAGTCTATTCAACTTGGTG -3'
Posted On2013-11-08