Incidental Mutation 'R0920:Ccdc33'
ID82821
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
MMRRC Submission 039070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0920 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58033672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 429 (D429G)
Ref Sequence ENSEMBL: ENSMUSP00000112613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: D429G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: D429G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: D614G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: D614G

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: D429G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: D429G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153106
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: D614G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik C T 16: 90,927,379 E125K probably damaging Het
Adamts16 A G 13: 70,763,561 probably benign Het
Adgra3 A G 5: 49,961,161 V1015A probably benign Het
Armc5 G T 7: 128,240,319 A270S probably damaging Het
Cacng1 A C 11: 107,705,856 probably benign Het
Ccdc88b G T 19: 6,846,649 A1412E probably benign Het
Clock A T 5: 76,230,320 S578T possibly damaging Het
Crp T C 1: 172,698,522 F58S probably damaging Het
Dlg5 T A 14: 24,176,397 Q125L probably damaging Het
Eif3i T C 4: 129,595,257 probably benign Het
Gm13124 T C 4: 144,561,126 probably benign Het
Gucy1a2 A C 9: 3,759,472 D426A probably damaging Het
Hpcal1 C T 12: 17,791,097 probably benign Het
Inf2 T A 12: 112,610,287 probably benign Het
Kdm7a A G 6: 39,151,322 L525P probably damaging Het
Kirrel3 A T 9: 35,028,352 I152F probably damaging Het
Knl1 T A 2: 119,069,828 I670K probably benign Het
Krt76 T C 15: 101,892,439 T141A possibly damaging Het
Ldb3 T C 14: 34,567,503 T249A probably benign Het
Magi3 A T 3: 104,034,191 probably null Het
Mfn1 A G 3: 32,534,236 probably null Het
Myb G T 10: 21,126,234 T736K possibly damaging Het
Myo5b A C 18: 74,625,641 K231T probably benign Het
Myt1l T A 12: 29,886,139 C909S unknown Het
Npas4 C A 19: 4,986,316 E607* probably null Het
Nphp3 A G 9: 104,031,907 N772S probably benign Het
Nup88 G T 11: 70,956,320 P288Q possibly damaging Het
Olfr166 A T 16: 19,486,930 I31F probably benign Het
Pknox1 C A 17: 31,596,891 Q240K probably damaging Het
Plce1 A C 19: 38,736,521 T1439P probably damaging Het
Ppp1r42 T A 1: 9,999,525 N104I probably damaging Het
Prkar2a T A 9: 108,719,297 probably benign Het
Stox2 C T 8: 47,193,018 R469Q probably damaging Het
Syna A G 5: 134,559,102 V331A probably benign Het
Vmn1r58 A T 7: 5,410,789 N147K probably benign Het
Zdhhc6 A T 19: 55,311,701 L148H probably damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 intron probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCCTAGCTCCTGACAGTAAG -3'
(R):5'- AGACACATTTGTGTGGCCCTCC -3'

Sequencing Primer
(F):5'- CTCCTGACAGTAAGCCTGG -3'
(R):5'- TCCTAATACTCCCAGGAGAGATGAG -3'
Posted On2013-11-08