Incidental Mutation 'R0920:Hpcal1'
ID82827
Institutional Source Beutler Lab
Gene Symbol Hpcal1
Ensembl Gene ENSMUSG00000071379
Gene Namehippocalcin-like 1
SynonymsVnsl3, neural visinin-like 3, VILIP3, visinin like 3, Nvp3
MMRRC Submission 039070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0920 (G1)
Quality Score176
Status Validated
Chromosome12
Chromosomal Location17690856-17791933 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 17791097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071858] [ENSMUST00000222944]
Predicted Effect probably benign
Transcript: ENSMUST00000071858
SMART Domains Protein: ENSMUSP00000071756
Gene: ENSMUSG00000071379

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 5.78e-7 SMART
EFh 148 176 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222944
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik C T 16: 90,927,379 E125K probably damaging Het
Adamts16 A G 13: 70,763,561 probably benign Het
Adgra3 A G 5: 49,961,161 V1015A probably benign Het
Armc5 G T 7: 128,240,319 A270S probably damaging Het
Cacng1 A C 11: 107,705,856 probably benign Het
Ccdc33 T C 9: 58,033,672 D429G probably damaging Het
Ccdc88b G T 19: 6,846,649 A1412E probably benign Het
Clock A T 5: 76,230,320 S578T possibly damaging Het
Crp T C 1: 172,698,522 F58S probably damaging Het
Dlg5 T A 14: 24,176,397 Q125L probably damaging Het
Eif3i T C 4: 129,595,257 probably benign Het
Gm13124 T C 4: 144,561,126 probably benign Het
Gucy1a2 A C 9: 3,759,472 D426A probably damaging Het
Inf2 T A 12: 112,610,287 probably benign Het
Kdm7a A G 6: 39,151,322 L525P probably damaging Het
Kirrel3 A T 9: 35,028,352 I152F probably damaging Het
Knl1 T A 2: 119,069,828 I670K probably benign Het
Krt76 T C 15: 101,892,439 T141A possibly damaging Het
Ldb3 T C 14: 34,567,503 T249A probably benign Het
Magi3 A T 3: 104,034,191 probably null Het
Mfn1 A G 3: 32,534,236 probably null Het
Myb G T 10: 21,126,234 T736K possibly damaging Het
Myo5b A C 18: 74,625,641 K231T probably benign Het
Myt1l T A 12: 29,886,139 C909S unknown Het
Npas4 C A 19: 4,986,316 E607* probably null Het
Nphp3 A G 9: 104,031,907 N772S probably benign Het
Nup88 G T 11: 70,956,320 P288Q possibly damaging Het
Olfr166 A T 16: 19,486,930 I31F probably benign Het
Pknox1 C A 17: 31,596,891 Q240K probably damaging Het
Plce1 A C 19: 38,736,521 T1439P probably damaging Het
Ppp1r42 T A 1: 9,999,525 N104I probably damaging Het
Prkar2a T A 9: 108,719,297 probably benign Het
Stox2 C T 8: 47,193,018 R469Q probably damaging Het
Syna A G 5: 134,559,102 V331A probably benign Het
Vmn1r58 A T 7: 5,410,789 N147K probably benign Het
Zdhhc6 A T 19: 55,311,701 L148H probably damaging Het
Other mutations in Hpcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Hpcal1 APN 12 17791145 missense probably benign 0.00
IGL00957:Hpcal1 APN 12 17787590 missense probably benign 0.17
R0137:Hpcal1 UTSW 12 17786388 missense probably damaging 1.00
R1490:Hpcal1 UTSW 12 17786224 missense probably benign
R5843:Hpcal1 UTSW 12 17791199 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTCCAGGTCTCTAAGTGTG -3'
(R):5'- TTTACAAGCAAAGCTGAACATGGCAG -3'

Sequencing Primer
(F):5'- tgacttttgctccatcccc -3'
(R):5'- AGGCCAAGCCTGTGTTTC -3'
Posted On2013-11-08