Incidental Mutation 'R0920:Npas4'
ID82838
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Nameneuronal PAS domain protein 4
SynonymsNpas4, LE-PAS, Nxf
MMRRC Submission 039070-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock #R0920 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4984355-4989971 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 4986316 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 607 (E607*)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
Predicted Effect probably null
Transcript: ENSMUST00000056129
AA Change: E607*
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: E607*

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik C T 16: 90,927,379 E125K probably damaging Het
Adamts16 A G 13: 70,763,561 probably benign Het
Adgra3 A G 5: 49,961,161 V1015A probably benign Het
Armc5 G T 7: 128,240,319 A270S probably damaging Het
Cacng1 A C 11: 107,705,856 probably benign Het
Ccdc33 T C 9: 58,033,672 D429G probably damaging Het
Ccdc88b G T 19: 6,846,649 A1412E probably benign Het
Clock A T 5: 76,230,320 S578T possibly damaging Het
Crp T C 1: 172,698,522 F58S probably damaging Het
Dlg5 T A 14: 24,176,397 Q125L probably damaging Het
Eif3i T C 4: 129,595,257 probably benign Het
Gm13124 T C 4: 144,561,126 probably benign Het
Gucy1a2 A C 9: 3,759,472 D426A probably damaging Het
Hpcal1 C T 12: 17,791,097 probably benign Het
Inf2 T A 12: 112,610,287 probably benign Het
Kdm7a A G 6: 39,151,322 L525P probably damaging Het
Kirrel3 A T 9: 35,028,352 I152F probably damaging Het
Knl1 T A 2: 119,069,828 I670K probably benign Het
Krt76 T C 15: 101,892,439 T141A possibly damaging Het
Ldb3 T C 14: 34,567,503 T249A probably benign Het
Magi3 A T 3: 104,034,191 probably null Het
Mfn1 A G 3: 32,534,236 probably null Het
Myb G T 10: 21,126,234 T736K possibly damaging Het
Myo5b A C 18: 74,625,641 K231T probably benign Het
Myt1l T A 12: 29,886,139 C909S unknown Het
Nphp3 A G 9: 104,031,907 N772S probably benign Het
Nup88 G T 11: 70,956,320 P288Q possibly damaging Het
Olfr166 A T 16: 19,486,930 I31F probably benign Het
Pknox1 C A 17: 31,596,891 Q240K probably damaging Het
Plce1 A C 19: 38,736,521 T1439P probably damaging Het
Ppp1r42 T A 1: 9,999,525 N104I probably damaging Het
Prkar2a T A 9: 108,719,297 probably benign Het
Stox2 C T 8: 47,193,018 R469Q probably damaging Het
Syna A G 5: 134,559,102 V331A probably benign Het
Vmn1r58 A T 7: 5,410,789 N147K probably benign Het
Zdhhc6 A T 19: 55,311,701 L148H probably damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 4987327 missense possibly damaging 0.93
IGL01865:Npas4 APN 19 4985791 nonsense probably null
IGL02746:Npas4 APN 19 4986667 missense probably damaging 0.99
IGL03061:Npas4 APN 19 4986337 missense probably damaging 1.00
IGL03340:Npas4 APN 19 4985066 utr 3 prime probably benign
R0879:Npas4 UTSW 19 4986916 missense probably benign
R1751:Npas4 UTSW 19 4988183 missense probably benign 0.05
R1767:Npas4 UTSW 19 4988183 missense probably benign 0.05
R2066:Npas4 UTSW 19 4987414 missense probably damaging 0.99
R2201:Npas4 UTSW 19 4987364 missense probably benign 0.06
R3973:Npas4 UTSW 19 4986551 missense probably benign
R4117:Npas4 UTSW 19 4987363 missense probably damaging 0.99
R4846:Npas4 UTSW 19 4986777 missense probably benign 0.34
R5007:Npas4 UTSW 19 4989656 missense possibly damaging 0.61
R6155:Npas4 UTSW 19 4986870 missense probably damaging 1.00
R6255:Npas4 UTSW 19 4986375 missense probably damaging 1.00
R6488:Npas4 UTSW 19 4985983 missense probably damaging 1.00
Z1177:Npas4 UTSW 19 4986242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGTCAACCAGGAAGTCCAG -3'
(R):5'- TCCTACCAAGACTTACTTCGCCCAG -3'

Sequencing Primer
(F):5'- TCCAGGGTTTAAGATCCAGGC -3'
(R):5'- CCAGGAGGGATGCAGTTTTC -3'
Posted On2013-11-08