Incidental Mutation 'R0972:Fbxo18'
ID82847
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
MMRRC Submission 039101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R0972 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 11764088 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,131 R478Q probably damaging Het
Adgrf5 A T 17: 43,450,983 S1190C probably damaging Het
Akr1a1 T C 4: 116,640,007 probably null Het
Bco2 A T 9: 50,536,315 D369E probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Brsk2 C G 7: 141,993,704 probably benign Het
Cct8 A G 16: 87,486,620 V269A possibly damaging Het
Cdh12 A T 15: 21,237,764 Q28H probably benign Het
Cep290 A G 10: 100,518,762 T896A probably benign Het
Chrm2 T A 6: 36,524,466 N419K possibly damaging Het
Clasp2 A T 9: 113,847,705 H168L possibly damaging Het
Cog3 A T 14: 75,717,170 M643K probably benign Het
Col6a5 A G 9: 105,940,285 S276P unknown Het
Colgalt2 T C 1: 152,471,744 V143A probably damaging Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Ddx56 A T 11: 6,267,718 M1K probably null Het
Dnah3 C T 7: 120,035,340 probably null Het
Dnah6 T C 6: 73,159,193 T988A possibly damaging Het
Esp15 T A 17: 39,642,666 F15I possibly damaging Het
Gm8773 T A 5: 5,575,512 D69E probably benign Het
Gucy1b2 A T 14: 62,408,678 I572N possibly damaging Het
Gucy1b2 T C 14: 62,414,369 I393V possibly damaging Het
Herc1 C A 9: 66,372,145 R112S probably damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Itga7 G A 10: 128,942,877 R291H probably damaging Het
Jag1 A G 2: 137,083,451 L1077S possibly damaging Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klrc2 T C 6: 129,658,763 Y134C probably damaging Het
Map2k2 C A 10: 81,119,648 D67E probably benign Het
Mest G A 6: 30,740,684 W14* probably null Het
Mier2 A G 10: 79,544,621 probably benign Het
Mog A G 17: 37,017,532 V169A probably benign Het
Mov10l1 T C 15: 89,021,279 V879A probably damaging Het
Mrgpra9 A G 7: 47,235,455 S155P probably damaging Het
Mtmr10 A G 7: 64,326,709 D418G probably damaging Het
Mtpn T C 6: 35,521,976 D58G probably null Het
Myh8 A G 11: 67,297,759 R1056G probably damaging Het
Nek1 T A 8: 61,089,431 probably null Het
Olfr1043 A C 2: 86,162,304 L215R possibly damaging Het
Olfr1282 T C 2: 111,335,418 Y220C probably benign Het
Olfr883 T A 9: 38,026,560 F251L possibly damaging Het
Pcnx G A 12: 81,913,412 D181N probably damaging Het
Pdzrn4 A G 15: 92,757,711 D495G probably benign Het
Plppr3 A G 10: 79,865,086 S641P probably damaging Het
Pramef6 T A 4: 143,896,963 T214S probably benign Het
Prelp A T 1: 133,914,676 Y244N probably damaging Het
Prg2 C A 2: 84,982,049 N34K probably benign Het
Ptp4a1 A G 1: 30,944,999 V46A possibly damaging Het
Rpl6 A G 5: 121,208,502 D222G possibly damaging Het
Rtp1 A T 16: 23,431,308 D141V probably damaging Het
Sacs T A 14: 61,211,963 Y3819* probably null Het
Serinc5 A G 13: 92,688,620 T186A probably benign Het
Slc15a2 A G 16: 36,757,139 S422P probably benign Het
Slc2a8 A T 2: 32,975,367 V366D probably benign Het
Smarca1 T C X: 47,849,987 R715G possibly damaging Het
Spdef C T 17: 27,715,023 A275T probably damaging Het
Tcf21 T C 10: 22,819,722 K61R probably benign Het
Tep1 A G 14: 50,824,296 probably benign Het
Thada G A 17: 84,429,062 probably benign Het
Thap11 T A 8: 105,856,178 I273N probably damaging Het
Tmem129 T A 5: 33,654,768 E262V possibly damaging Het
Tnxb A G 17: 34,685,143 Y1086C probably damaging Het
Togaram2 A G 17: 71,707,314 Y619C probably damaging Het
Top1 C T 2: 160,721,025 A717V probably damaging Het
Trpm7 G A 2: 126,805,049 P1507S probably benign Het
Ubr2 A T 17: 46,934,261 probably null Het
Usp30 T C 5: 114,111,864 probably benign Het
Vmn1r3 T A 4: 3,185,125 I61F probably damaging Het
Zbtb22 C T 17: 33,917,352 T157I possibly damaging Het
Zfp677 A T 17: 21,398,310 H543L probably damaging Het
Zranb3 G T 1: 127,956,646 P1001Q probably damaging Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R1420:Fbxo18 UTSW 2 11767682 missense probably benign 0.01
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4504:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4894:Fbxo18 UTSW 2 11762960 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
R7460:Fbxo18 UTSW 2 11756685 missense probably benign 0.38
R7541:Fbxo18 UTSW 2 11749537 missense probably benign 0.05
R8000:Fbxo18 UTSW 2 11767289 missense probably benign 0.21
R8010:Fbxo18 UTSW 2 11767632 missense probably benign 0.15
R8056:Fbxo18 UTSW 2 11743630 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCATTTCCCAGAGTATCCCTCACG -3'
(R):5'- AAACCAAGGCCCAGTTGTCCTGTC -3'

Sequencing Primer
(F):5'- AGAGTATCCCTCACGGCCTC -3'
(R):5'- CGCTCTTCTGAGAATCATGGC -3'
Posted On2013-11-08