Incidental Mutation 'R0972:Fbh1'
ID 82847
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission 039101-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R0972 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 11768899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
AlphaFold Q8K2I9
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 41,208,168 (GRCm39) R478Q probably damaging Het
Adgrf5 A T 17: 43,761,874 (GRCm39) S1190C probably damaging Het
Akr1a1 T C 4: 116,497,204 (GRCm39) probably null Het
Bco2 A T 9: 50,447,615 (GRCm39) D369E probably benign Het
Blm A T 7: 80,163,118 (GRCm39) S78T probably benign Het
Brsk2 C G 7: 141,547,441 (GRCm39) probably benign Het
Cct8 A G 16: 87,283,508 (GRCm39) V269A possibly damaging Het
Cdh12 A T 15: 21,237,850 (GRCm39) Q28H probably benign Het
Cep290 A G 10: 100,354,624 (GRCm39) T896A probably benign Het
Chrm2 T A 6: 36,501,401 (GRCm39) N419K possibly damaging Het
Clasp2 A T 9: 113,676,773 (GRCm39) H168L possibly damaging Het
Cog3 A T 14: 75,954,610 (GRCm39) M643K probably benign Het
Col6a5 A G 9: 105,817,484 (GRCm39) S276P unknown Het
Colgalt2 T C 1: 152,347,495 (GRCm39) V143A probably damaging Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Ddx56 A T 11: 6,217,718 (GRCm39) M1K probably null Het
Dnah3 C T 7: 119,634,563 (GRCm39) probably null Het
Dnah6 T C 6: 73,136,176 (GRCm39) T988A possibly damaging Het
Esp15 T A 17: 39,953,557 (GRCm39) F15I possibly damaging Het
Fam237b T A 5: 5,625,512 (GRCm39) D69E probably benign Het
Gucy1b2 A T 14: 62,646,127 (GRCm39) I572N possibly damaging Het
Gucy1b2 T C 14: 62,651,818 (GRCm39) I393V possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Herc1 C A 9: 66,279,427 (GRCm39) R112S probably damaging Het
Itga7 G A 10: 128,778,746 (GRCm39) R291H probably damaging Het
Jag1 A G 2: 136,925,371 (GRCm39) L1077S possibly damaging Het
Klb G C 5: 65,506,089 (GRCm39) R112P possibly damaging Het
Klrc2 T C 6: 129,635,726 (GRCm39) Y134C probably damaging Het
Map2k2 C A 10: 80,955,482 (GRCm39) D67E probably benign Het
Mest G A 6: 30,740,683 (GRCm39) W14* probably null Het
Mier2 A G 10: 79,380,455 (GRCm39) probably benign Het
Mog A G 17: 37,328,424 (GRCm39) V169A probably benign Het
Mov10l1 T C 15: 88,905,482 (GRCm39) V879A probably damaging Het
Mrgpra9 A G 7: 46,885,203 (GRCm39) S155P probably damaging Het
Mtmr10 A G 7: 63,976,457 (GRCm39) D418G probably damaging Het
Mtpn T C 6: 35,498,911 (GRCm39) D58G probably null Het
Myh8 A G 11: 67,188,585 (GRCm39) R1056G probably damaging Het
Nek1 T A 8: 61,542,465 (GRCm39) probably null Het
Or4k38 T C 2: 111,165,763 (GRCm39) Y220C probably benign Het
Or5al7 A C 2: 85,992,648 (GRCm39) L215R possibly damaging Het
Or8b36 T A 9: 37,937,856 (GRCm39) F251L possibly damaging Het
Pcnx1 G A 12: 81,960,186 (GRCm39) D181N probably damaging Het
Pdzrn4 A G 15: 92,655,592 (GRCm39) D495G probably benign Het
Plppr3 A G 10: 79,700,920 (GRCm39) S641P probably damaging Het
Pramel11 T A 4: 143,623,533 (GRCm39) T214S probably benign Het
Prelp A T 1: 133,842,414 (GRCm39) Y244N probably damaging Het
Prg2 C A 2: 84,812,393 (GRCm39) N34K probably benign Het
Ptp4a1 A G 1: 30,984,080 (GRCm39) V46A possibly damaging Het
Rpl6 A G 5: 121,346,565 (GRCm39) D222G possibly damaging Het
Rtp1 A T 16: 23,250,058 (GRCm39) D141V probably damaging Het
Sacs T A 14: 61,449,412 (GRCm39) Y3819* probably null Het
Serinc5 A G 13: 92,825,128 (GRCm39) T186A probably benign Het
Slc15a2 A G 16: 36,577,501 (GRCm39) S422P probably benign Het
Slc2a8 A T 2: 32,865,379 (GRCm39) V366D probably benign Het
Smarca1 T C X: 46,938,864 (GRCm39) R715G possibly damaging Het
Spdef C T 17: 27,933,997 (GRCm39) A275T probably damaging Het
Tcf21 T C 10: 22,695,621 (GRCm39) K61R probably benign Het
Tep1 A G 14: 51,061,753 (GRCm39) probably benign Het
Thada G A 17: 84,736,490 (GRCm39) probably benign Het
Thap11 T A 8: 106,582,810 (GRCm39) I273N probably damaging Het
Tmem129 T A 5: 33,812,112 (GRCm39) E262V possibly damaging Het
Tnxb A G 17: 34,904,117 (GRCm39) Y1086C probably damaging Het
Togaram2 A G 17: 72,014,309 (GRCm39) Y619C probably damaging Het
Top1 C T 2: 160,562,945 (GRCm39) A717V probably damaging Het
Trpm7 G A 2: 126,646,969 (GRCm39) P1507S probably benign Het
Ubr2 A T 17: 47,245,187 (GRCm39) probably null Het
Usp30 T C 5: 114,249,925 (GRCm39) probably benign Het
Vmn1r3 T A 4: 3,185,125 (GRCm39) I61F probably damaging Het
Zbtb22 C T 17: 34,136,326 (GRCm39) T157I possibly damaging Het
Zfp677 A T 17: 21,618,572 (GRCm39) H543L probably damaging Het
Zranb3 G T 1: 127,884,383 (GRCm39) P1001Q probably damaging Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7361:Fbh1 UTSW 2 11,751,887 (GRCm39) missense probably damaging 1.00
R7460:Fbh1 UTSW 2 11,761,496 (GRCm39) missense probably benign 0.38
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8000:Fbh1 UTSW 2 11,772,100 (GRCm39) missense probably benign 0.21
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R8883:Fbh1 UTSW 2 11,753,922 (GRCm39) missense probably benign 0.21
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9306:Fbh1 UTSW 2 11,772,387 (GRCm39) missense probably benign 0.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCATTTCCCAGAGTATCCCTCACG -3'
(R):5'- AAACCAAGGCCCAGTTGTCCTGTC -3'

Sequencing Primer
(F):5'- AGAGTATCCCTCACGGCCTC -3'
(R):5'- CGCTCTTCTGAGAATCATGGC -3'
Posted On 2013-11-08