Incidental Mutation 'R0972:Myh8'
ID82888
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 039101-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R0972 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67297759 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1056 (R1056G)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably damaging
Transcript: ENSMUST00000019625
AA Change: R1056G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: R1056G

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,131 R478Q probably damaging Het
Adgrf5 A T 17: 43,450,983 S1190C probably damaging Het
Akr1a1 T C 4: 116,640,007 probably null Het
Bco2 A T 9: 50,536,315 D369E probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Brsk2 C G 7: 141,993,704 probably benign Het
Cct8 A G 16: 87,486,620 V269A possibly damaging Het
Cdh12 A T 15: 21,237,764 Q28H probably benign Het
Cep290 A G 10: 100,518,762 T896A probably benign Het
Chrm2 T A 6: 36,524,466 N419K possibly damaging Het
Clasp2 A T 9: 113,847,705 H168L possibly damaging Het
Cog3 A T 14: 75,717,170 M643K probably benign Het
Col6a5 A G 9: 105,940,285 S276P unknown Het
Colgalt2 T C 1: 152,471,744 V143A probably damaging Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Ddx56 A T 11: 6,267,718 M1K probably null Het
Dnah3 C T 7: 120,035,340 probably null Het
Dnah6 T C 6: 73,159,193 T988A possibly damaging Het
Esp15 T A 17: 39,642,666 F15I possibly damaging Het
Fbxo18 C T 2: 11,764,088 probably benign Het
Gm8773 T A 5: 5,575,512 D69E probably benign Het
Gucy1b2 A T 14: 62,408,678 I572N possibly damaging Het
Gucy1b2 T C 14: 62,414,369 I393V possibly damaging Het
Herc1 C A 9: 66,372,145 R112S probably damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Itga7 G A 10: 128,942,877 R291H probably damaging Het
Jag1 A G 2: 137,083,451 L1077S possibly damaging Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klrc2 T C 6: 129,658,763 Y134C probably damaging Het
Map2k2 C A 10: 81,119,648 D67E probably benign Het
Mest G A 6: 30,740,684 W14* probably null Het
Mier2 A G 10: 79,544,621 probably benign Het
Mog A G 17: 37,017,532 V169A probably benign Het
Mov10l1 T C 15: 89,021,279 V879A probably damaging Het
Mrgpra9 A G 7: 47,235,455 S155P probably damaging Het
Mtmr10 A G 7: 64,326,709 D418G probably damaging Het
Mtpn T C 6: 35,521,976 D58G probably null Het
Nek1 T A 8: 61,089,431 probably null Het
Olfr1043 A C 2: 86,162,304 L215R possibly damaging Het
Olfr1282 T C 2: 111,335,418 Y220C probably benign Het
Olfr883 T A 9: 38,026,560 F251L possibly damaging Het
Pcnx G A 12: 81,913,412 D181N probably damaging Het
Pdzrn4 A G 15: 92,757,711 D495G probably benign Het
Plppr3 A G 10: 79,865,086 S641P probably damaging Het
Pramef6 T A 4: 143,896,963 T214S probably benign Het
Prelp A T 1: 133,914,676 Y244N probably damaging Het
Prg2 C A 2: 84,982,049 N34K probably benign Het
Ptp4a1 A G 1: 30,944,999 V46A possibly damaging Het
Rpl6 A G 5: 121,208,502 D222G possibly damaging Het
Rtp1 A T 16: 23,431,308 D141V probably damaging Het
Sacs T A 14: 61,211,963 Y3819* probably null Het
Serinc5 A G 13: 92,688,620 T186A probably benign Het
Slc15a2 A G 16: 36,757,139 S422P probably benign Het
Slc2a8 A T 2: 32,975,367 V366D probably benign Het
Smarca1 T C X: 47,849,987 R715G possibly damaging Het
Spdef C T 17: 27,715,023 A275T probably damaging Het
Tcf21 T C 10: 22,819,722 K61R probably benign Het
Tep1 A G 14: 50,824,296 probably benign Het
Thada G A 17: 84,429,062 probably benign Het
Thap11 T A 8: 105,856,178 I273N probably damaging Het
Tmem129 T A 5: 33,654,768 E262V possibly damaging Het
Tnxb A G 17: 34,685,143 Y1086C probably damaging Het
Togaram2 A G 17: 71,707,314 Y619C probably damaging Het
Top1 C T 2: 160,721,025 A717V probably damaging Het
Trpm7 G A 2: 126,805,049 P1507S probably benign Het
Ubr2 A T 17: 46,934,261 probably null Het
Usp30 T C 5: 114,111,864 probably benign Het
Vmn1r3 T A 4: 3,185,125 I61F probably damaging Het
Zbtb22 C T 17: 33,917,352 T157I possibly damaging Het
Zfp677 A T 17: 21,398,310 H543L probably damaging Het
Zranb3 G T 1: 127,956,646 P1001Q probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67303655 missense probably benign 0.44
R7825:Myh8 UTSW 11 67303712 missense possibly damaging 0.94
R8003:Myh8 UTSW 11 67299760 missense probably damaging 1.00
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67303674 missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67301424 missense probably damaging 0.99
Z1177:Myh8 UTSW 11 67308355 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCTGGATGAAAATATCGCCAAGCTGAC -3'
(R):5'- CTCCTTCCTTTAGACAGAACAGCAGAC -3'

Sequencing Primer
(F):5'- TATCGCCAAGCTGACCAAGG -3'
(R):5'- GACAGAACAGCAGACACATTAATATG -3'
Posted On2013-11-08