Mutagenetix > Incidental Mutation

Incidental Mutation 'R0972:Pdzrn4'

82900

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

039101-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R0972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92757711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 495 (D495G)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: D256G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: D256G

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: D495G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: D495G

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

97% (72/74)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	G	A	8: 40,755,131	R478Q	probably damaging	Het
Adgrf5	A	T	17: 43,450,983	S1190C	probably damaging	Het
Akr1a1	T	C	4: 116,640,007		probably null	Het
Bco2	A	T	9: 50,536,315	D369E	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Brsk2	C	G	7: 141,993,704		probably benign	Het
Cct8	A	G	16: 87,486,620	V269A	possibly damaging	Het
Cdh12	A	T	15: 21,237,764	Q28H	probably benign	Het
Cep290	A	G	10: 100,518,762	T896A	probably benign	Het
Chrm2	T	A	6: 36,524,466	N419K	possibly damaging	Het
Clasp2	A	T	9: 113,847,705	H168L	possibly damaging	Het
Cog3	A	T	14: 75,717,170	M643K	probably benign	Het
Col6a5	A	G	9: 105,940,285	S276P	unknown	Het
Colgalt2	T	C	1: 152,471,744	V143A	probably damaging	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
Ddx56	A	T	11: 6,267,718	M1K	probably null	Het
Dnah3	C	T	7: 120,035,340		probably null	Het
Dnah6	T	C	6: 73,159,193	T988A	possibly damaging	Het
Esp15	T	A	17: 39,642,666	F15I	possibly damaging	Het
Fbxo18	C	T	2: 11,764,088		probably benign	Het
Gm8773	T	A	5: 5,575,512	D69E	probably benign	Het
Gucy1b2	A	T	14: 62,408,678	I572N	possibly damaging	Het
Gucy1b2	T	C	14: 62,414,369	I393V	possibly damaging	Het
Herc1	C	A	9: 66,372,145	R112S	probably damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Itga7	G	A	10: 128,942,877	R291H	probably damaging	Het
Jag1	A	G	2: 137,083,451	L1077S	possibly damaging	Het
Klb	G	C	5: 65,348,746	R112P	possibly damaging	Het
Klrc2	T	C	6: 129,658,763	Y134C	probably damaging	Het
Map2k2	C	A	10: 81,119,648	D67E	probably benign	Het
Mest	G	A	6: 30,740,684	W14*	probably null	Het
Mier2	A	G	10: 79,544,621		probably benign	Het
Mog	A	G	17: 37,017,532	V169A	probably benign	Het
Mov10l1	T	C	15: 89,021,279	V879A	probably damaging	Het
Mrgpra9	A	G	7: 47,235,455	S155P	probably damaging	Het
Mtmr10	A	G	7: 64,326,709	D418G	probably damaging	Het
Mtpn	T	C	6: 35,521,976	D58G	probably null	Het
Myh8	A	G	11: 67,297,759	R1056G	probably damaging	Het
Nek1	T	A	8: 61,089,431		probably null	Het
Olfr1043	A	C	2: 86,162,304	L215R	possibly damaging	Het
Olfr1282	T	C	2: 111,335,418	Y220C	probably benign	Het
Olfr883	T	A	9: 38,026,560	F251L	possibly damaging	Het
Pcnx	G	A	12: 81,913,412	D181N	probably damaging	Het
Plppr3	A	G	10: 79,865,086	S641P	probably damaging	Het
Pramef6	T	A	4: 143,896,963	T214S	probably benign	Het
Prelp	A	T	1: 133,914,676	Y244N	probably damaging	Het
Prg2	C	A	2: 84,982,049	N34K	probably benign	Het
Ptp4a1	A	G	1: 30,944,999	V46A	possibly damaging	Het
Rpl6	A	G	5: 121,208,502	D222G	possibly damaging	Het
Rtp1	A	T	16: 23,431,308	D141V	probably damaging	Het
Sacs	T	A	14: 61,211,963	Y3819*	probably null	Het
Serinc5	A	G	13: 92,688,620	T186A	probably benign	Het
Slc15a2	A	G	16: 36,757,139	S422P	probably benign	Het
Slc2a8	A	T	2: 32,975,367	V366D	probably benign	Het
Smarca1	T	C	X: 47,849,987	R715G	possibly damaging	Het
Spdef	C	T	17: 27,715,023	A275T	probably damaging	Het
Tcf21	T	C	10: 22,819,722	K61R	probably benign	Het
Tep1	A	G	14: 50,824,296		probably benign	Het
Thada	G	A	17: 84,429,062		probably benign	Het
Thap11	T	A	8: 105,856,178	I273N	probably damaging	Het
Tmem129	T	A	5: 33,654,768	E262V	possibly damaging	Het
Tnxb	A	G	17: 34,685,143	Y1086C	probably damaging	Het
Togaram2	A	G	17: 71,707,314	Y619C	probably damaging	Het
Top1	C	T	2: 160,721,025	A717V	probably damaging	Het
Trpm7	G	A	2: 126,805,049	P1507S	probably benign	Het
Ubr2	A	T	17: 46,934,261		probably null	Het
Usp30	T	C	5: 114,111,864		probably benign	Het
Vmn1r3	T	A	4: 3,185,125	I61F	probably damaging	Het
Zbtb22	C	T	17: 33,917,352	T157I	possibly damaging	Het
Zfp677	A	T	17: 21,398,310	H543L	probably damaging	Het
Zranb3	G	T	1: 127,956,646	P1001Q	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCTCTGAAGAGAATCGCCGACAAAG -3'
(R):5'- ACGTTACCTCATGGACAATGGTTGC -3'

Sequencing Primer
(F):5'- CGACAAAGAGAGTTGGTTGG -3'
(R):5'- TTCAGGCTTTCCAAGCAGG -3'

Posted On

2013-11-08