Incidental Mutation 'R0972:Rtp1'
ID82901
Institutional Source Beutler Lab
Gene Symbol Rtp1
Ensembl Gene ENSMUSG00000033383
Gene Namereceptor transporter protein 1
SynonymsLOC239766, LOC385871
MMRRC Submission 039101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0972 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23429133-23433960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23431308 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 141 (D141V)
Ref Sequence ENSEMBL: ENSMUSP00000043416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038730]
Predicted Effect probably damaging
Transcript: ENSMUST00000038730
AA Change: D141V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043416
Gene: ENSMUSG00000033383
AA Change: D141V

DomainStartEndE-ValueType
zf-3CxxC 87 197 3.5e-39 SMART
transmembrane domain 235 257 N/A INTRINSIC
Meta Mutation Damage Score 0.2203 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility and abnormal olfactory bulb development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,131 R478Q probably damaging Het
Adgrf5 A T 17: 43,450,983 S1190C probably damaging Het
Akr1a1 T C 4: 116,640,007 probably null Het
Bco2 A T 9: 50,536,315 D369E probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Brsk2 C G 7: 141,993,704 probably benign Het
Cct8 A G 16: 87,486,620 V269A possibly damaging Het
Cdh12 A T 15: 21,237,764 Q28H probably benign Het
Cep290 A G 10: 100,518,762 T896A probably benign Het
Chrm2 T A 6: 36,524,466 N419K possibly damaging Het
Clasp2 A T 9: 113,847,705 H168L possibly damaging Het
Cog3 A T 14: 75,717,170 M643K probably benign Het
Col6a5 A G 9: 105,940,285 S276P unknown Het
Colgalt2 T C 1: 152,471,744 V143A probably damaging Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Ddx56 A T 11: 6,267,718 M1K probably null Het
Dnah3 C T 7: 120,035,340 probably null Het
Dnah6 T C 6: 73,159,193 T988A possibly damaging Het
Esp15 T A 17: 39,642,666 F15I possibly damaging Het
Fbxo18 C T 2: 11,764,088 probably benign Het
Gm8773 T A 5: 5,575,512 D69E probably benign Het
Gucy1b2 A T 14: 62,408,678 I572N possibly damaging Het
Gucy1b2 T C 14: 62,414,369 I393V possibly damaging Het
Herc1 C A 9: 66,372,145 R112S probably damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Itga7 G A 10: 128,942,877 R291H probably damaging Het
Jag1 A G 2: 137,083,451 L1077S possibly damaging Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klrc2 T C 6: 129,658,763 Y134C probably damaging Het
Map2k2 C A 10: 81,119,648 D67E probably benign Het
Mest G A 6: 30,740,684 W14* probably null Het
Mier2 A G 10: 79,544,621 probably benign Het
Mog A G 17: 37,017,532 V169A probably benign Het
Mov10l1 T C 15: 89,021,279 V879A probably damaging Het
Mrgpra9 A G 7: 47,235,455 S155P probably damaging Het
Mtmr10 A G 7: 64,326,709 D418G probably damaging Het
Mtpn T C 6: 35,521,976 D58G probably null Het
Myh8 A G 11: 67,297,759 R1056G probably damaging Het
Nek1 T A 8: 61,089,431 probably null Het
Olfr1043 A C 2: 86,162,304 L215R possibly damaging Het
Olfr1282 T C 2: 111,335,418 Y220C probably benign Het
Olfr883 T A 9: 38,026,560 F251L possibly damaging Het
Pcnx G A 12: 81,913,412 D181N probably damaging Het
Pdzrn4 A G 15: 92,757,711 D495G probably benign Het
Plppr3 A G 10: 79,865,086 S641P probably damaging Het
Pramef6 T A 4: 143,896,963 T214S probably benign Het
Prelp A T 1: 133,914,676 Y244N probably damaging Het
Prg2 C A 2: 84,982,049 N34K probably benign Het
Ptp4a1 A G 1: 30,944,999 V46A possibly damaging Het
Rpl6 A G 5: 121,208,502 D222G possibly damaging Het
Sacs T A 14: 61,211,963 Y3819* probably null Het
Serinc5 A G 13: 92,688,620 T186A probably benign Het
Slc15a2 A G 16: 36,757,139 S422P probably benign Het
Slc2a8 A T 2: 32,975,367 V366D probably benign Het
Smarca1 T C X: 47,849,987 R715G possibly damaging Het
Spdef C T 17: 27,715,023 A275T probably damaging Het
Tcf21 T C 10: 22,819,722 K61R probably benign Het
Tep1 A G 14: 50,824,296 probably benign Het
Thada G A 17: 84,429,062 probably benign Het
Thap11 T A 8: 105,856,178 I273N probably damaging Het
Tmem129 T A 5: 33,654,768 E262V possibly damaging Het
Tnxb A G 17: 34,685,143 Y1086C probably damaging Het
Togaram2 A G 17: 71,707,314 Y619C probably damaging Het
Top1 C T 2: 160,721,025 A717V probably damaging Het
Trpm7 G A 2: 126,805,049 P1507S probably benign Het
Ubr2 A T 17: 46,934,261 probably null Het
Usp30 T C 5: 114,111,864 probably benign Het
Vmn1r3 T A 4: 3,185,125 I61F probably damaging Het
Zbtb22 C T 17: 33,917,352 T157I possibly damaging Het
Zfp677 A T 17: 21,398,310 H543L probably damaging Het
Zranb3 G T 1: 127,956,646 P1001Q probably damaging Het
Other mutations in Rtp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02276:Rtp1 APN 16 23431313 missense probably benign 0.07
IGL02329:Rtp1 APN 16 23431193 missense probably damaging 1.00
IGL02432:Rtp1 APN 16 23431404 missense probably damaging 1.00
IGL02690:Rtp1 APN 16 23431382 missense probably damaging 1.00
IGL03046:Rtp1 UTSW 16 23429294 missense probably benign 0.30
P0028:Rtp1 UTSW 16 23429366 missense probably damaging 1.00
R0319:Rtp1 UTSW 16 23431460 missense probably damaging 1.00
R0377:Rtp1 UTSW 16 23431284 missense probably damaging 0.98
R1498:Rtp1 UTSW 16 23431220 missense probably benign 0.00
R1751:Rtp1 UTSW 16 23431374 missense probably damaging 0.98
R1767:Rtp1 UTSW 16 23431374 missense probably damaging 0.98
R1900:Rtp1 UTSW 16 23429299 missense probably benign
R1921:Rtp1 UTSW 16 23431410 missense probably damaging 1.00
R1922:Rtp1 UTSW 16 23431410 missense probably damaging 1.00
R1927:Rtp1 UTSW 16 23431209 missense probably damaging 1.00
R2102:Rtp1 UTSW 16 23431358 missense probably benign 0.04
R5118:Rtp1 UTSW 16 23431535 missense probably benign 0.00
R5484:Rtp1 UTSW 16 23429275 missense probably benign
R5614:Rtp1 UTSW 16 23431190 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTTGGGCACTCACATAGAGCAAGG -3'
(R):5'- GATGATGAGCATCAAAACCGTGGC -3'

Sequencing Primer
(F):5'- CTGGGGACTGTCAACACAC -3'
(R):5'- AGCCTGAGCCTGTTTCAGC -3'
Posted On2013-11-08