Incidental Mutation 'R0973:Or1j14'
ID 82918
Institutional Source Beutler Lab
Gene Symbol Or1j14
Ensembl Gene ENSMUSG00000111869
Gene Name olfactory receptor family 1 subfamily J member 14
Synonyms GA_x6K02T2NLDC-33222024-33222962, MOR136-4, Olfr342
MMRRC Submission 039102-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.290) question?
Stock # R0973 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36415010-36420802 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36418020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 199 (I199V)
Ref Sequence ENSEMBL: ENSMUSP00000149751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074192] [ENSMUST00000216275]
AlphaFold Q8VGK7
Predicted Effect probably benign
Transcript: ENSMUST00000074192
AA Change: I199V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073818
Gene: ENSMUSG00000111869
AA Change: I199V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-56 PFAM
Pfam:7tm_1 41 290 2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213794
Predicted Effect probably benign
Transcript: ENSMUST00000216275
AA Change: I199V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Asic5 C T 3: 81,915,755 (GRCm39) probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cep152 A G 2: 125,436,819 (GRCm39) S574P probably benign Het
Cep250 A G 2: 155,806,209 (GRCm39) probably benign Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Gm12500 T C 3: 107,993,792 (GRCm39) probably null Het
Gm6327 T C 16: 12,578,977 (GRCm39) noncoding transcript Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Ift172 T C 5: 31,415,262 (GRCm39) probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lgals8 A T 13: 12,466,276 (GRCm39) probably benign Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Mcpt8 T C 14: 56,321,257 (GRCm39) probably benign Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Naa25 T C 5: 121,576,779 (GRCm39) probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Pm20d2 T A 4: 33,174,734 (GRCm39) probably benign Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Skint1 T G 4: 111,885,412 (GRCm39) probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Spag7 A G 11: 70,560,008 (GRCm39) probably benign Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Or1j14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Or1j14 APN 2 36,418,005 (GRCm39) missense probably benign 0.22
IGL01372:Or1j14 APN 2 36,417,463 (GRCm39) missense probably benign 0.00
IGL01747:Or1j14 APN 2 36,417,844 (GRCm39) missense probably damaging 1.00
IGL01836:Or1j14 APN 2 36,417,837 (GRCm39) nonsense probably null
IGL02409:Or1j14 APN 2 36,418,165 (GRCm39) missense probably damaging 1.00
IGL02578:Or1j14 APN 2 36,418,156 (GRCm39) missense probably damaging 1.00
IGL03344:Or1j14 APN 2 36,418,140 (GRCm39) missense probably damaging 1.00
IGL03396:Or1j14 APN 2 36,417,692 (GRCm39) missense probably benign 0.00
R0086:Or1j14 UTSW 2 36,417,462 (GRCm39) missense possibly damaging 0.69
R0427:Or1j14 UTSW 2 36,417,994 (GRCm39) missense probably damaging 1.00
R0973:Or1j14 UTSW 2 36,418,020 (GRCm39) missense probably benign 0.13
R0974:Or1j14 UTSW 2 36,418,020 (GRCm39) missense probably benign 0.13
R2183:Or1j14 UTSW 2 36,417,723 (GRCm39) nonsense probably null
R2437:Or1j14 UTSW 2 36,418,258 (GRCm39) missense probably damaging 1.00
R4060:Or1j14 UTSW 2 36,417,426 (GRCm39) start codon destroyed probably null 0.01
R4982:Or1j14 UTSW 2 36,417,409 (GRCm39) critical splice acceptor site probably null
R5070:Or1j14 UTSW 2 36,417,778 (GRCm39) missense probably damaging 1.00
R6244:Or1j14 UTSW 2 36,418,353 (GRCm39) missense probably benign 0.00
R8350:Or1j14 UTSW 2 36,418,176 (GRCm39) missense probably damaging 1.00
R8690:Or1j14 UTSW 2 36,418,207 (GRCm39) missense probably benign 0.22
R9105:Or1j14 UTSW 2 36,418,294 (GRCm39) missense probably damaging 1.00
R9224:Or1j14 UTSW 2 36,417,838 (GRCm39) missense probably benign 0.00
R9249:Or1j14 UTSW 2 36,417,559 (GRCm39) missense probably damaging 1.00
R9274:Or1j14 UTSW 2 36,417,559 (GRCm39) missense probably damaging 1.00
R9465:Or1j14 UTSW 2 36,417,898 (GRCm39) missense probably benign 0.02
R9644:Or1j14 UTSW 2 36,417,777 (GRCm39) missense probably damaging 1.00
R9700:Or1j14 UTSW 2 36,418,313 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGTATGTAGCCATCTGCCATCCTC -3'
(R):5'- CCCATCATTGTGAGCACAGTCTCC -3'

Sequencing Primer
(F):5'- ATCATGAGTCAGAGCCTCTGTC -3'
(R):5'- TGAGCACAGTCTCCTACTGAG -3'
Posted On 2013-11-08