Incidental Mutation 'R0973:Slc33a1'
ID 82927
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Name solute carrier family 33 (acetyl-CoA transporter), member 1
Synonyms Acatn, D630022N01Rik
MMRRC Submission 039102-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.687) question?
Stock # R0973 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 63849744-63872154 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63850725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 533 (F533S)
Ref Sequence ENSEMBL: ENSMUSP00000123986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
AlphaFold Q99J27
Predicted Effect probably benign
Transcript: ENSMUST00000029402
AA Change: F533S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: F533S

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160883
AA Change: F533S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: F533S

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161659
AA Change: F533S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: F533S

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Meta Mutation Damage Score 0.5983 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Asic5 C T 3: 81,915,755 (GRCm39) probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cep152 A G 2: 125,436,819 (GRCm39) S574P probably benign Het
Cep250 A G 2: 155,806,209 (GRCm39) probably benign Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Gm12500 T C 3: 107,993,792 (GRCm39) probably null Het
Gm6327 T C 16: 12,578,977 (GRCm39) noncoding transcript Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Ift172 T C 5: 31,415,262 (GRCm39) probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lgals8 A T 13: 12,466,276 (GRCm39) probably benign Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Mcpt8 T C 14: 56,321,257 (GRCm39) probably benign Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Naa25 T C 5: 121,576,779 (GRCm39) probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Pm20d2 T A 4: 33,174,734 (GRCm39) probably benign Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Skint1 T G 4: 111,885,412 (GRCm39) probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Spag7 A G 11: 70,560,008 (GRCm39) probably benign Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63,871,433 (GRCm39) missense probably benign
IGL01361:Slc33a1 APN 3 63,850,833 (GRCm39) missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63,850,768 (GRCm39) missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63,855,562 (GRCm39) missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63,850,753 (GRCm39) missense probably benign
IGL02877:Slc33a1 APN 3 63,850,806 (GRCm39) missense probably benign
IGL03196:Slc33a1 APN 3 63,871,151 (GRCm39) missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63,871,178 (GRCm39) missense probably damaging 0.98
skeletor UTSW 3 63,852,122 (GRCm39) missense possibly damaging 0.89
R0973:Slc33a1 UTSW 3 63,850,725 (GRCm39) missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63,850,725 (GRCm39) missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63,861,315 (GRCm39) missense probably benign
R1513:Slc33a1 UTSW 3 63,871,376 (GRCm39) missense probably damaging 1.00
R1618:Slc33a1 UTSW 3 63,855,650 (GRCm39) missense possibly damaging 0.66
R2038:Slc33a1 UTSW 3 63,855,577 (GRCm39) missense probably damaging 1.00
R2095:Slc33a1 UTSW 3 63,871,376 (GRCm39) missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63,871,145 (GRCm39) missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63,871,167 (GRCm39) missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63,850,709 (GRCm39) missense probably benign
R6425:Slc33a1 UTSW 3 63,871,484 (GRCm39) missense probably benign
R6641:Slc33a1 UTSW 3 63,861,327 (GRCm39) missense probably benign 0.09
R6709:Slc33a1 UTSW 3 63,852,122 (GRCm39) missense possibly damaging 0.89
R6866:Slc33a1 UTSW 3 63,850,744 (GRCm39) missense probably benign 0.02
R7360:Slc33a1 UTSW 3 63,855,075 (GRCm39) missense possibly damaging 0.87
R7768:Slc33a1 UTSW 3 63,855,039 (GRCm39) missense possibly damaging 0.69
R8560:Slc33a1 UTSW 3 63,850,773 (GRCm39) missense possibly damaging 0.82
R9195:Slc33a1 UTSW 3 63,871,188 (GRCm39) missense probably damaging 1.00
R9747:Slc33a1 UTSW 3 63,861,424 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ttgctcCACTTGATACATTGTACCAACA -3'
(R):5'- gccatctgagaccctgtctcTATAAAGC -3'

Sequencing Primer
(F):5'- CCAAAAGGGTTGTTTCCTAGC -3'
(R):5'- TCGTGTGTTACAGCTCTGGA -3'
Posted On 2013-11-08