Incidental Mutation 'R0973:Gp2'
ID82951
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
MMRRC Submission 039102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119454543 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 65 (L65Q)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect probably damaging
Transcript: ENSMUST00000033255
AA Change: L65Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954
AA Change: L65Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207887
AA Change: L65Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3264 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Asic5 C T 3: 82,008,448 probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Cep152 A G 2: 125,594,899 S574P probably benign Het
Cep250 A G 2: 155,964,289 probably benign Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Dnah9 A T 11: 66,005,837 probably null Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Gm12500 T C 3: 108,086,476 probably null Het
Gm6327 T C 16: 12,761,113 noncoding transcript Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Ift172 T C 5: 31,257,918 probably benign Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lgals8 A T 13: 12,451,395 probably benign Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Mcpt8 T C 14: 56,083,800 probably benign Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Naa25 T C 5: 121,438,716 probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Pm20d2 T A 4: 33,174,734 probably benign Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Skint1 T G 4: 112,028,215 probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Spag7 A G 11: 70,669,182 probably benign Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Usp24 A G 4: 106,413,678 probably null Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
PIT4687001:Gp2 UTSW 7 119451578 missense possibly damaging 0.48
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R2285:Gp2 UTSW 7 119450085 missense possibly damaging 0.82
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5732:Gp2 UTSW 7 119449108 missense probably damaging 1.00
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8343:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8344:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGACAATGCCATCTCCAAG -3'
(R):5'- ACTGCAATGTGTACCTATTGGCCTC -3'

Sequencing Primer
(F):5'- CATCTCCAAGGATGGGGTGAG -3'
(R):5'- CACTGGGATCATTAGGGCATTC -3'
Posted On2013-11-08