Mutagenetix > Incidental Mutation

Incidental Mutation 'R0973:Atp6v0a1'

82967

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a1

Ensembl Gene

ENSMUSG00000019302

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A1

Synonyms

Atp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1

MMRRC Submission

039102-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101009452-101063719 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 101055491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 770 (L770*)

Ref Sequence

ENSEMBL: ENSMUSP00000131848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]

AlphaFold

Q9Z1G4

Predicted Effect

probably null
Transcript: ENSMUST00000044721
AA Change: L770*

SMART Domains

Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: L770*

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000092663
AA Change: L764*

SMART Domains

Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: L764*

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	823	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000103110
AA Change: L771*

SMART Domains

Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: L771*

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	829	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168757
AA Change: L770*

SMART Domains

Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: L770*

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.4%
20x: 92.6%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Asic5	C	T	3: 82,008,448		probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
B3gnt5	T	A	16: 19,770,010	D326E	probably damaging	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Cep152	A	G	2: 125,594,899	S574P	probably benign	Het
Cep250	A	G	2: 155,964,289		probably benign	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Dnah9	A	T	11: 66,005,837		probably null	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Gm12500	T	C	3: 108,086,476		probably null	Het
Gm6327	T	C	16: 12,761,113		noncoding transcript	Het
Golga4	T	C	9: 118,537,273	I365T	probably damaging	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Ift172	T	C	5: 31,257,918		probably benign	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lgals8	A	T	13: 12,451,395		probably benign	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Mcpt8	T	C	14: 56,083,800		probably benign	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Naa25	T	C	5: 121,438,716		probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Pm20d2	T	A	4: 33,174,734		probably benign	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Skint1	T	G	4: 112,028,215		probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Spag7	A	G	11: 70,669,182		probably benign	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Usp24	T	A	4: 106,371,079	Y780*	probably null	Het
Usp24	A	G	4: 106,413,678		probably null	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in Atp6v0a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Atp6v0a1	APN	11	101030505	critical splice donor site	probably null
IGL01024:Atp6v0a1	APN	11	101048439	missense	probably benign	0.00
IGL01390:Atp6v0a1	APN	11	101043802	missense	probably benign	0.01
IGL02214:Atp6v0a1	APN	11	101039840	missense	probably benign	0.01
IGL02639:Atp6v0a1	APN	11	101055518	missense	possibly damaging	0.90
R0125:Atp6v0a1	UTSW	11	101038851	splice site	probably null
R0193:Atp6v0a1	UTSW	11	101048482	missense	possibly damaging	0.90
R0265:Atp6v0a1	UTSW	11	101048515	missense	possibly damaging	0.80
R0973:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R0974:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R1460:Atp6v0a1	UTSW	11	101033998	missense	probably damaging	1.00
R1580:Atp6v0a1	UTSW	11	101029204	missense	probably damaging	1.00
R1625:Atp6v0a1	UTSW	11	101055554	missense	probably damaging	1.00
R1644:Atp6v0a1	UTSW	11	101038786	missense	possibly damaging	0.65
R1779:Atp6v0a1	UTSW	11	101026685	missense	probably benign	0.01
R2895:Atp6v0a1	UTSW	11	101044598	missense	probably benign
R2926:Atp6v0a1	UTSW	11	101043948	missense	probably damaging	0.99
R3727:Atp6v0a1	UTSW	11	101030420	missense	probably benign	0.01
R3943:Atp6v0a1	UTSW	11	101055517	missense	probably benign	0.00
R4820:Atp6v0a1	UTSW	11	101042950	missense	probably benign	0.00
R5119:Atp6v0a1	UTSW	11	101020515	missense	probably benign	0.02
R5250:Atp6v0a1	UTSW	11	101043044	missense	possibly damaging	0.94
R5377:Atp6v0a1	UTSW	11	101055587	missense	probably damaging	1.00
R5393:Atp6v0a1	UTSW	11	101038807	missense	possibly damaging	0.95
R5497:Atp6v0a1	UTSW	11	101029185	missense	probably damaging	1.00
R5787:Atp6v0a1	UTSW	11	101018574	missense	probably benign	0.04
R6054:Atp6v0a1	UTSW	11	101039889	missense	possibly damaging	0.91
R6076:Atp6v0a1	UTSW	11	101055060	missense	probably damaging	1.00
R6889:Atp6v0a1	UTSW	11	101029183	missense	possibly damaging	0.87
R7035:Atp6v0a1	UTSW	11	101027357	missense	probably damaging	0.97
R7084:Atp6v0a1	UTSW	11	101034042	missense	probably damaging	1.00
R7212:Atp6v0a1	UTSW	11	101043957	missense	probably benign	0.08
R8289:Atp6v0a1	UTSW	11	101034105	missense	probably damaging	1.00
R8461:Atp6v0a1	UTSW	11	101044574	missense	possibly damaging	0.60
R8680:Atp6v0a1	UTSW	11	101062403	makesense	probably null
R8725:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8727:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8935:Atp6v0a1	UTSW	11	101038693	missense	possibly damaging	0.90
R9658:Atp6v0a1	UTSW	11	101018588	missense	probably benign	0.18
R9762:Atp6v0a1	UTSW	11	101055601	missense	possibly damaging	0.46
R9779:Atp6v0a1	UTSW	11	101034112	missense	probably damaging	1.00
X0023:Atp6v0a1	UTSW	11	101044597	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CATCCAGCTCCTGTCTCCAAGAATG -3'
(R):5'- GTGCCAAGCAAGAGGACTGTCTAC -3'

Sequencing Primer
(F):5'- TAGTGATCTTGCCCAAAGCG -3'
(R):5'- CTACTCTTTGTGAGCAAAGGC -3'

Posted On

2013-11-08