Mutagenetix > Incidental Mutation

Incidental Mutation 'R0973:B3gnt5'

82978

Institutional Source

Beutler Lab

Gene Symbol

B3gnt5

Ensembl Gene

ENSMUSG00000022686

Gene Name

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

Synonyms

MMRRC Submission

039102-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R0973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19760208-19772753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19770010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 326 (D326E)

Ref Sequence

ENSEMBL: ENSMUSP00000126157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]

AlphaFold

Q8BGY6

Predicted Effect

probably damaging
Transcript: ENSMUST00000079780
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: D326E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119468
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: D326E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121344
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: D326E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152845

Predicted Effect

probably damaging
Transcript: ENSMUST00000164397
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: D326E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Meta Mutation Damage Score

0.3207

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.4%
20x: 92.6%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Asic5	C	T	3: 82,008,448		probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
Atp6v0a1	T	A	11: 101,055,491	L770*	probably null	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Cep152	A	G	2: 125,594,899	S574P	probably benign	Het
Cep250	A	G	2: 155,964,289		probably benign	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Dnah9	A	T	11: 66,005,837		probably null	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Gm12500	T	C	3: 108,086,476		probably null	Het
Gm6327	T	C	16: 12,761,113		noncoding transcript	Het
Golga4	T	C	9: 118,537,273	I365T	probably damaging	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Ift172	T	C	5: 31,257,918		probably benign	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lgals8	A	T	13: 12,451,395		probably benign	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Mcpt8	T	C	14: 56,083,800		probably benign	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Naa25	T	C	5: 121,438,716		probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Pm20d2	T	A	4: 33,174,734		probably benign	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Skint1	T	G	4: 112,028,215		probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Spag7	A	G	11: 70,669,182		probably benign	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Usp24	T	A	4: 106,371,079	Y780*	probably null	Het
Usp24	A	G	4: 106,413,678		probably null	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in B3gnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:B3gnt5	APN	16	19769213	missense	probably damaging	1.00
IGL01503:B3gnt5	APN	16	19769781	missense	probably damaging	1.00
IGL02623:B3gnt5	APN	16	19769610	missense	probably damaging	1.00
IGL02978:B3gnt5	APN	16	19769994	missense	probably damaging	1.00
IGL03355:B3gnt5	APN	16	19769153	missense	probably benign	0.01
IGL03388:B3gnt5	APN	16	19770051	missense	possibly damaging	0.83
R0180:B3gnt5	UTSW	16	19769100	missense	possibly damaging	0.48
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0974:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R1034:B3gnt5	UTSW	16	19769484	missense	probably damaging	1.00
R1435:B3gnt5	UTSW	16	19769174	missense	probably damaging	0.99
R1480:B3gnt5	UTSW	16	19769867	missense	probably damaging	1.00
R1533:B3gnt5	UTSW	16	19769614	missense	probably damaging	1.00
R1920:B3gnt5	UTSW	16	19769544	missense	probably benign	0.34
R3962:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R3963:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R4620:B3gnt5	UTSW	16	19769882	missense	probably benign	0.37
R4948:B3gnt5	UTSW	16	19769144	missense	probably benign
R4987:B3gnt5	UTSW	16	19769202	missense	probably damaging	1.00
R5027:B3gnt5	UTSW	16	19769694	missense	probably damaging	1.00
R6415:B3gnt5	UTSW	16	19770009	missense	probably damaging	1.00
R7027:B3gnt5	UTSW	16	19769990	missense	probably damaging	1.00
R7224:B3gnt5	UTSW	16	19769753	missense	probably benign	0.06
R7261:B3gnt5	UTSW	16	19769373	missense	probably damaging	1.00
R7369:B3gnt5	UTSW	16	19769660	missense	probably benign	0.00
R8818:B3gnt5	UTSW	16	19769597	missense	possibly damaging	0.53
Z1176:B3gnt5	UTSW	16	19769810	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTCCTGTTAGGGATAAAAGCAGC -3'
(R):5'- CAAATGCAGCCCAACAAGGGTATG -3'

Sequencing Primer
(F):5'- TCTATGAGGCATCGCAGAC -3'
(R):5'- CCAACAAGGGTATGAATTCCTG -3'

Posted On

2013-11-08