Incidental Mutation 'R0974:Dnah14'
ID 82984
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 181579710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 3081 (V3081A)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160345
SMART Domains Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

DomainStartEndE-ValueType
Pfam:MT 46 381 2.1e-41 PFAM
Pfam:AAA_9 401 524 8.3e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160793
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: V3081A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1343 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACGCATTCTCCCTAACATACCTG -3'
(R):5'- ACCTCTGCTTTGCAATCTGAAGGAC -3'

Sequencing Primer
(F):5'- AATCTGCCTGACTTCAACCC -3'
(R):5'- ATGTCTGATACTTGGGAGACAC -3'
Posted On 2013-11-08