Incidental Mutation 'R0974:Cd46'
ID 82986
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene Name CD46 antigen, complement regulatory protein
Synonyms CD46, Mcp
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 194719134-194774557 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 194724300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 366 (*366W)
Ref Sequence ENSEMBL: ENSMUSP00000123931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
AlphaFold O88174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083614
Predicted Effect probably benign
Transcript: ENSMUST00000159563
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161772
Predicted Effect probably null
Transcript: ENSMUST00000162650
AA Change: *366W
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: *366W

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194487
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 194,767,732 (GRCm39) missense probably benign 0.01
IGL03029:Cd46 APN 1 194,768,451 (GRCm39) missense probably benign 0.43
R0269:Cd46 UTSW 1 194,746,996 (GRCm39) missense probably benign 0.00
R0375:Cd46 UTSW 1 194,768,472 (GRCm39) missense probably benign 0.00
R0627:Cd46 UTSW 1 194,774,494 (GRCm39) missense probably benign 0.03
R0784:Cd46 UTSW 1 194,774,502 (GRCm39) missense possibly damaging 0.96
R0892:Cd46 UTSW 1 194,764,920 (GRCm39) missense possibly damaging 0.78
R0973:Cd46 UTSW 1 194,724,300 (GRCm39) makesense probably null
R0973:Cd46 UTSW 1 194,724,300 (GRCm39) makesense probably null
R1224:Cd46 UTSW 1 194,744,706 (GRCm39) missense possibly damaging 0.66
R1716:Cd46 UTSW 1 194,760,117 (GRCm39) missense probably benign 0.21
R1863:Cd46 UTSW 1 194,765,931 (GRCm39) missense probably damaging 1.00
R2000:Cd46 UTSW 1 194,760,012 (GRCm39) missense probably benign 0.00
R2152:Cd46 UTSW 1 194,744,721 (GRCm39) missense probably benign 0.42
R2153:Cd46 UTSW 1 194,744,721 (GRCm39) missense probably benign 0.42
R4452:Cd46 UTSW 1 194,767,668 (GRCm39) missense possibly damaging 0.84
R4860:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
R4860:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
R4934:Cd46 UTSW 1 194,765,107 (GRCm39) intron probably benign
R5156:Cd46 UTSW 1 194,767,693 (GRCm39) missense possibly damaging 0.90
R5287:Cd46 UTSW 1 194,744,719 (GRCm39) missense possibly damaging 0.65
R5303:Cd46 UTSW 1 194,744,707 (GRCm39) missense probably benign
R5403:Cd46 UTSW 1 194,744,719 (GRCm39) missense possibly damaging 0.65
R5487:Cd46 UTSW 1 194,750,478 (GRCm39) critical splice acceptor site probably null
R5505:Cd46 UTSW 1 194,767,688 (GRCm39) missense possibly damaging 0.88
R5538:Cd46 UTSW 1 194,750,478 (GRCm39) critical splice acceptor site probably null
R6721:Cd46 UTSW 1 194,765,939 (GRCm39) missense probably damaging 1.00
R6731:Cd46 UTSW 1 194,765,775 (GRCm39) splice site probably null
R7226:Cd46 UTSW 1 194,724,314 (GRCm39) missense possibly damaging 0.84
R7633:Cd46 UTSW 1 194,765,927 (GRCm39) missense probably null 0.01
R8277:Cd46 UTSW 1 194,747,030 (GRCm39) missense probably damaging 0.96
R8672:Cd46 UTSW 1 194,764,949 (GRCm39) missense probably benign 0.09
R9153:Cd46 UTSW 1 194,774,479 (GRCm39) missense possibly damaging 0.88
R9435:Cd46 UTSW 1 194,767,720 (GRCm39) missense probably damaging 0.99
R9455:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TACTGAGAACCCTTGGTGAGCTGC -3'
(R):5'- CCAAGCCTTTTACCCTCCAAGTGG -3'

Sequencing Primer
(F):5'- TGCAGGGGCTGAAATGTG -3'
(R):5'- GGTAGCAGTTGTACCTATACACG -3'
Posted On 2013-11-08