Incidental Mutation 'R0974:Olfr1231'
ID82990
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
MMRRC Submission 039103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0974 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89303184 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 136 (I136N)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099786
AA Change: I136N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I136N

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216144
AA Change: I136N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Dnah9 A T 11: 66,005,837 probably null Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Usp24 A G 4: 106,413,678 probably null Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
PIT4305001:Olfr1231 UTSW 2 89303383 missense probably benign 0.05
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4208:Olfr1231 UTSW 2 89302926 missense probably damaging 1.00
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4693:Olfr1231 UTSW 2 89303277 missense probably benign 0.07
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R6894:Olfr1231 UTSW 2 89303493 missense probably damaging 1.00
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAAAGCACATAGCCCCACTGTTG -3'
(R):5'- GGTCTCACACAGAATCCACGCTTG -3'

Sequencing Primer
(F):5'- ACTATGATGCCCAGCTTATGTG -3'
(R):5'- CACGCTTGCAAAAAATACTGTTC -3'
Posted On2013-11-08