Incidental Mutation 'R0974:Rims4'
ID82994
Institutional Source Beutler Lab
Gene Symbol Rims4
Ensembl Gene ENSMUSG00000035226
Gene Nameregulating synaptic membrane exocytosis 4
SynonymsRim4
MMRRC Submission 039103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0974 (G1)
Quality Score89
Status Not validated
Chromosome2
Chromosomal Location163859751-163918683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 163863929 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 262 (V262M)
Ref Sequence ENSEMBL: ENSMUSP00000045637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044734] [ENSMUST00000044798] [ENSMUST00000109396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044734
AA Change: V262M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045637
Gene: ENSMUSG00000035226
AA Change: V262M

DomainStartEndE-ValueType
C2 129 232 1.42e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044798
SMART Domains Protein: ENSMUSP00000048326
Gene: ENSMUSG00000035238

DomainStartEndE-ValueType
Pfam:Ion_trans_2 78 153 1.2e-20 PFAM
Pfam:Ion_trans_2 184 267 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109396
SMART Domains Protein: ENSMUSP00000105023
Gene: ENSMUSG00000035238

DomainStartEndE-ValueType
Pfam:Ion_trans_2 62 134 5.2e-21 PFAM
Pfam:Ion_trans_2 165 248 1.6e-17 PFAM
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induec allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Dnah9 A T 11: 66,005,837 probably null Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Usp24 A G 4: 106,413,678 probably null Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Rims4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Rims4 APN 2 163864102 missense probably damaging 1.00
IGL01980:Rims4 APN 2 163865782 splice site probably benign
demure UTSW 2 163864120 missense probably damaging 0.99
diminutive UTSW 2 163864865 critical splice donor site probably null
R0115:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0152:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0153:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0173:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0481:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0702:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0735:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1013:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1014:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1017:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1104:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1209:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1401:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1554:Rims4 UTSW 2 163879122 missense probably damaging 1.00
R1618:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R2104:Rims4 UTSW 2 163864865 critical splice donor site probably null
R2171:Rims4 UTSW 2 163864126 splice site probably null
R3611:Rims4 UTSW 2 163879206 missense possibly damaging 0.50
R3735:Rims4 UTSW 2 163863985 missense possibly damaging 0.88
R3836:Rims4 UTSW 2 163918653 missense possibly damaging 0.86
R4685:Rims4 UTSW 2 163864994 nonsense probably null
R4849:Rims4 UTSW 2 163865543 missense probably benign 0.11
R4873:Rims4 UTSW 2 163865523 missense probably null 0.00
R4875:Rims4 UTSW 2 163865523 missense probably null 0.00
R5337:Rims4 UTSW 2 163865843 missense probably benign 0.00
R5415:Rims4 UTSW 2 163918676 missense probably benign 0.26
R5646:Rims4 UTSW 2 163864017 nonsense probably null
R6487:Rims4 UTSW 2 163864897 missense possibly damaging 0.93
R7213:Rims4 UTSW 2 163864061 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTAGCCAACCCACTGGGAAAG -3'
(R):5'- TCAGTTGCAAGACGTAACCAGCC -3'

Sequencing Primer
(F):5'- CCACTGGGAAAGGGAAGGTC -3'
(R):5'- CGTGTGGGGAAACTACGG -3'
Posted On2013-11-08