Incidental Mutation 'R0974:Or13e8'
ID 83000
Institutional Source Beutler Lab
Gene Symbol Or13e8
Ensembl Gene ENSMUSG00000050215
Gene Name olfactory receptor family 13 subfamily E member 8
Synonyms Olfr70, GA_x6K02T2N78B-16239704-16240654, MOR262-10, mOR6
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43695000-43700807 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43696706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000060748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055545] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000167153]
AlphaFold Q80ZX9
Predicted Effect probably damaging
Transcript: ENSMUST00000055545
AA Change: S156P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060748
Gene: ENSMUSG00000050215
AA Change: S156P

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.6e-51 PFAM
Pfam:7tm_1 41 289 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158322
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Or13e8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0111:Or13e8 UTSW 4 43,696,648 (GRCm39) missense probably damaging 0.99
R0501:Or13e8 UTSW 4 43,697,079 (GRCm39) missense probably damaging 1.00
R0973:Or13e8 UTSW 4 43,696,706 (GRCm39) missense probably damaging 1.00
R0973:Or13e8 UTSW 4 43,696,706 (GRCm39) missense probably damaging 1.00
R1413:Or13e8 UTSW 4 43,697,011 (GRCm39) missense possibly damaging 0.87
R1452:Or13e8 UTSW 4 43,696,823 (GRCm39) missense probably benign 0.12
R1574:Or13e8 UTSW 4 43,697,134 (GRCm39) missense possibly damaging 0.85
R1574:Or13e8 UTSW 4 43,697,134 (GRCm39) missense possibly damaging 0.85
R2159:Or13e8 UTSW 4 43,697,110 (GRCm39) missense probably benign 0.01
R3011:Or13e8 UTSW 4 43,696,624 (GRCm39) missense probably damaging 1.00
R5493:Or13e8 UTSW 4 43,696,225 (GRCm39) missense possibly damaging 0.67
R5651:Or13e8 UTSW 4 43,696,636 (GRCm39) missense probably damaging 1.00
R6938:Or13e8 UTSW 4 43,696,286 (GRCm39) missense probably damaging 1.00
R6976:Or13e8 UTSW 4 43,697,170 (GRCm39) start codon destroyed probably null 0.99
R7315:Or13e8 UTSW 4 43,696,961 (GRCm39) missense probably damaging 1.00
R8912:Or13e8 UTSW 4 43,697,017 (GRCm39) missense probably benign 0.19
R9443:Or13e8 UTSW 4 43,696,591 (GRCm39) missense probably damaging 1.00
R9780:Or13e8 UTSW 4 43,697,193 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTAAGGATAGCAGCCAGGATG -3'
(R):5'- TGCTAGGGAACTCCTTCCTTGTGG -3'

Sequencing Primer
(F):5'- TAGCAGCCAGGATGAAAATGTAAG -3'
(R):5'- GATTGTGTTGGACACCCACC -3'
Posted On 2013-11-08