Mutagenetix > Incidental Mutation

Incidental Mutation 'R0974:Usp24'

83001

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

039103-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 106371079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 780 (Y780*)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably null
Transcript: ENSMUST00000094933
AA Change: Y779*

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: Y779*

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165709
AA Change: Y780*

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: Y780*

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.5%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
Atp6v0a1	T	A	11: 101,055,491	L770*	probably null	Het
B3gnt5	T	A	16: 19,770,010	D326E	probably damaging	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Dnah9	A	T	11: 66,005,837		probably null	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Golga4	T	C	9: 118,537,273	I365T	probably damaging	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Taf2	GCTTCTTCTTCTTCTTCTT	GCTTCTTCTTCTTCTT	15: 55,016,461		probably benign	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GCATACTCTCCTGACCAGCAGAAAG -3'
(R):5'- TGCACACCTGAGTGCAGACTAAAAG -3'

Sequencing Primer
(F):5'- AGAAAGACCTGTCCCGTCTG -3'
(R):5'- TGCAGACTAAAAGTTGCTGAC -3'

Posted On

2013-11-08