Incidental Mutation 'R0974:Usp24'
ID 83001
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2700066K03Rik, 2810030C21Rik
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 106173410-106298519 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 106228276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 780 (Y780*)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably null
Transcript: ENSMUST00000094933
AA Change: Y779*
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: Y779*

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165709
AA Change: Y780*
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: Y780*

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106,216,288 (GRCm39) missense probably benign
IGL00340:Usp24 APN 4 106,258,336 (GRCm39) missense probably damaging 0.99
IGL00480:Usp24 APN 4 106,225,303 (GRCm39) missense probably damaging 0.99
IGL00548:Usp24 APN 4 106,198,495 (GRCm39) missense probably damaging 0.96
IGL00655:Usp24 APN 4 106,247,515 (GRCm39) missense probably damaging 0.99
IGL00674:Usp24 APN 4 106,229,876 (GRCm39) splice site probably benign
IGL00718:Usp24 APN 4 106,266,901 (GRCm39) missense probably benign 0.10
IGL00803:Usp24 APN 4 106,242,723 (GRCm39) splice site probably benign
IGL01161:Usp24 APN 4 106,294,041 (GRCm39) missense probably benign 0.02
IGL01344:Usp24 APN 4 106,236,582 (GRCm39) missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106,237,296 (GRCm39) missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106,219,429 (GRCm39) missense probably benign 0.01
IGL01736:Usp24 APN 4 106,280,658 (GRCm39) missense probably benign 0.00
IGL01737:Usp24 APN 4 106,244,931 (GRCm39) missense probably benign 0.03
IGL01862:Usp24 APN 4 106,266,095 (GRCm39) splice site probably benign
IGL01981:Usp24 APN 4 106,232,965 (GRCm39) splice site probably benign
IGL02090:Usp24 APN 4 106,268,623 (GRCm39) missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106,244,690 (GRCm39) missense probably damaging 1.00
IGL02352:Usp24 APN 4 106,261,122 (GRCm39) missense probably damaging 1.00
IGL02359:Usp24 APN 4 106,261,122 (GRCm39) missense probably damaging 1.00
IGL02391:Usp24 APN 4 106,264,326 (GRCm39) missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106,293,557 (GRCm39) missense probably benign 0.07
IGL02537:Usp24 APN 4 106,249,564 (GRCm39) missense probably damaging 1.00
IGL02638:Usp24 APN 4 106,295,969 (GRCm39) splice site probably benign
IGL02638:Usp24 APN 4 106,295,967 (GRCm39) splice site probably benign
IGL02830:Usp24 APN 4 106,204,584 (GRCm39) missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106,249,599 (GRCm39) missense probably benign 0.09
IGL03280:Usp24 APN 4 106,237,627 (GRCm39) missense probably damaging 1.00
IGL03350:Usp24 APN 4 106,228,276 (GRCm39) nonsense probably null
BB010:Usp24 UTSW 4 106,285,686 (GRCm39) missense probably benign
BB020:Usp24 UTSW 4 106,285,686 (GRCm39) missense probably benign
IGL03098:Usp24 UTSW 4 106,228,230 (GRCm39) missense probably benign 0.11
R0035:Usp24 UTSW 4 106,225,224 (GRCm39) missense probably benign 0.18
R0044:Usp24 UTSW 4 106,269,281 (GRCm39) splice site probably benign
R0086:Usp24 UTSW 4 106,249,557 (GRCm39) missense probably damaging 0.98
R0125:Usp24 UTSW 4 106,254,496 (GRCm39) missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106,264,330 (GRCm39) missense probably damaging 1.00
R0240:Usp24 UTSW 4 106,271,601 (GRCm39) nonsense probably null
R0240:Usp24 UTSW 4 106,271,601 (GRCm39) nonsense probably null
R0491:Usp24 UTSW 4 106,259,302 (GRCm39) missense probably benign 0.41
R0687:Usp24 UTSW 4 106,277,701 (GRCm39) missense probably damaging 1.00
R0973:Usp24 UTSW 4 106,270,875 (GRCm39) splice site probably null
R0973:Usp24 UTSW 4 106,228,276 (GRCm39) nonsense probably null
R0973:Usp24 UTSW 4 106,228,276 (GRCm39) nonsense probably null
R0974:Usp24 UTSW 4 106,270,875 (GRCm39) splice site probably null
R1163:Usp24 UTSW 4 106,278,157 (GRCm39) missense probably benign
R1293:Usp24 UTSW 4 106,280,750 (GRCm39) missense probably benign 0.19
R1333:Usp24 UTSW 4 106,199,550 (GRCm39) missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106,219,130 (GRCm39) missense probably damaging 1.00
R1699:Usp24 UTSW 4 106,296,024 (GRCm39) missense probably damaging 0.99
R1728:Usp24 UTSW 4 106,217,618 (GRCm39) missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106,217,618 (GRCm39) missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106,234,756 (GRCm39) missense probably benign 0.04
R1917:Usp24 UTSW 4 106,267,483 (GRCm39) missense probably damaging 1.00
R2045:Usp24 UTSW 4 106,258,177 (GRCm39) missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106,256,310 (GRCm39) critical splice donor site probably null
R2436:Usp24 UTSW 4 106,266,842 (GRCm39) nonsense probably null
R2513:Usp24 UTSW 4 106,236,602 (GRCm39) splice site probably null
R3824:Usp24 UTSW 4 106,236,263 (GRCm39) missense probably benign
R3831:Usp24 UTSW 4 106,219,209 (GRCm39) critical splice donor site probably null
R3833:Usp24 UTSW 4 106,219,209 (GRCm39) critical splice donor site probably null
R3982:Usp24 UTSW 4 106,245,080 (GRCm39) missense probably benign 0.38
R4022:Usp24 UTSW 4 106,236,421 (GRCm39) splice site probably benign
R4067:Usp24 UTSW 4 106,216,286 (GRCm39) missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106,173,970 (GRCm39) missense probably benign 0.00
R4766:Usp24 UTSW 4 106,273,245 (GRCm39) missense probably damaging 1.00
R4771:Usp24 UTSW 4 106,219,377 (GRCm39) splice site probably null
R4798:Usp24 UTSW 4 106,217,359 (GRCm39) missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106,270,873 (GRCm39) critical splice donor site probably null
R4822:Usp24 UTSW 4 106,273,244 (GRCm39) missense probably damaging 0.98
R4906:Usp24 UTSW 4 106,245,834 (GRCm39) missense probably benign 0.20
R4934:Usp24 UTSW 4 106,283,743 (GRCm39) missense probably benign 0.29
R5074:Usp24 UTSW 4 106,277,644 (GRCm39) missense probably benign 0.12
R5151:Usp24 UTSW 4 106,256,309 (GRCm39) critical splice donor site probably null
R5220:Usp24 UTSW 4 106,239,500 (GRCm39) missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106,242,621 (GRCm39) missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106,198,411 (GRCm39) missense probably benign 0.18
R5285:Usp24 UTSW 4 106,264,230 (GRCm39) missense probably benign 0.00
R5292:Usp24 UTSW 4 106,275,460 (GRCm39) missense probably benign 0.06
R5294:Usp24 UTSW 4 106,219,554 (GRCm39) missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106,265,210 (GRCm39) missense probably damaging 1.00
R5517:Usp24 UTSW 4 106,232,871 (GRCm39) missense probably benign 0.02
R5522:Usp24 UTSW 4 106,229,918 (GRCm39) missense probably damaging 1.00
R5546:Usp24 UTSW 4 106,273,244 (GRCm39) missense probably damaging 0.98
R5756:Usp24 UTSW 4 106,219,680 (GRCm39) missense probably damaging 1.00
R5910:Usp24 UTSW 4 106,237,665 (GRCm39) missense probably damaging 0.99
R5972:Usp24 UTSW 4 106,225,264 (GRCm39) missense probably damaging 0.98
R6285:Usp24 UTSW 4 106,231,297 (GRCm39) splice site probably null
R6370:Usp24 UTSW 4 106,237,718 (GRCm39) missense probably null 0.20
R6630:Usp24 UTSW 4 106,245,032 (GRCm39) missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106,217,617 (GRCm39) missense probably damaging 1.00
R7027:Usp24 UTSW 4 106,219,441 (GRCm39) missense probably benign 0.21
R7088:Usp24 UTSW 4 106,244,743 (GRCm39) missense probably damaging 1.00
R7129:Usp24 UTSW 4 106,219,412 (GRCm39) missense probably damaging 1.00
R7131:Usp24 UTSW 4 106,239,500 (GRCm39) missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106,245,116 (GRCm39) critical splice donor site probably null
R7174:Usp24 UTSW 4 106,219,878 (GRCm39) splice site probably null
R7236:Usp24 UTSW 4 106,263,502 (GRCm39) splice site probably null
R7403:Usp24 UTSW 4 106,264,232 (GRCm39) missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106,236,304 (GRCm39) missense probably benign 0.00
R7475:Usp24 UTSW 4 106,199,550 (GRCm39) missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106,236,276 (GRCm39) missense probably damaging 1.00
R7782:Usp24 UTSW 4 106,173,771 (GRCm39) missense probably damaging 1.00
R7900:Usp24 UTSW 4 106,266,597 (GRCm39) missense probably damaging 1.00
R7933:Usp24 UTSW 4 106,285,686 (GRCm39) missense probably benign
R7940:Usp24 UTSW 4 106,287,741 (GRCm39) missense probably damaging 0.98
R8271:Usp24 UTSW 4 106,285,711 (GRCm39) missense probably damaging 0.98
R8348:Usp24 UTSW 4 106,225,933 (GRCm39) missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106,225,933 (GRCm39) missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106,230,953 (GRCm39) missense probably damaging 1.00
R8546:Usp24 UTSW 4 106,259,326 (GRCm39) missense probably benign 0.01
R8798:Usp24 UTSW 4 106,236,436 (GRCm39) missense probably benign 0.00
R8822:Usp24 UTSW 4 106,269,410 (GRCm39) missense probably benign 0.17
R8992:Usp24 UTSW 4 106,234,762 (GRCm39) missense probably benign 0.36
R9002:Usp24 UTSW 4 106,275,412 (GRCm39) missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106,236,251 (GRCm39) missense probably damaging 0.99
R9068:Usp24 UTSW 4 106,232,875 (GRCm39) missense probably benign 0.09
R9096:Usp24 UTSW 4 106,254,508 (GRCm39) missense probably benign 0.00
R9180:Usp24 UTSW 4 106,216,247 (GRCm39) missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106,244,681 (GRCm39) missense probably damaging 1.00
R9201:Usp24 UTSW 4 106,277,727 (GRCm39) missense probably benign 0.36
R9251:Usp24 UTSW 4 106,217,715 (GRCm39) missense probably benign 0.19
R9423:Usp24 UTSW 4 106,288,867 (GRCm39) missense probably damaging 1.00
R9459:Usp24 UTSW 4 106,199,555 (GRCm39) missense probably damaging 1.00
R9472:Usp24 UTSW 4 106,261,128 (GRCm39) missense probably benign 0.00
R9483:Usp24 UTSW 4 106,219,379 (GRCm39) missense probably damaging 0.99
R9534:Usp24 UTSW 4 106,264,312 (GRCm39) missense probably damaging 0.97
R9653:Usp24 UTSW 4 106,204,564 (GRCm39) missense probably benign 0.03
R9712:Usp24 UTSW 4 106,204,564 (GRCm39) missense probably benign 0.03
X0024:Usp24 UTSW 4 106,217,643 (GRCm39) missense probably benign 0.09
X0028:Usp24 UTSW 4 106,225,252 (GRCm39) missense probably benign 0.01
X0066:Usp24 UTSW 4 106,212,928 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCATACTCTCCTGACCAGCAGAAAG -3'
(R):5'- TGCACACCTGAGTGCAGACTAAAAG -3'

Sequencing Primer
(F):5'- AGAAAGACCTGTCCCGTCTG -3'
(R):5'- TGCAGACTAAAAGTTGCTGAC -3'
Posted On 2013-11-08