Incidental Mutation 'R0974:Dmtf1'
ID 83005
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Name cyclin D binding myb like transcription factor 1
Synonyms Dmp1
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.542) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 9168868-9211821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9177987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 391 (I391F)
Ref Sequence ENSEMBL: ENSMUSP00000092627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000196029] [ENSMUST00000184620] [ENSMUST00000184401] [ENSMUST00000184888] [ENSMUST00000184372]
AlphaFold Q8CE22
Predicted Effect possibly damaging
Transcript: ENSMUST00000071921
AA Change: I391F

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: I391F

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095017
AA Change: I391F

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: I391F

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183973
AA Change: I303F

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: I303F

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000184159
AA Change: I350F

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: I350F

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184903
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184370
Predicted Effect probably benign
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Meta Mutation Damage Score 0.2511 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9,186,070 (GRCm39) missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9,170,056 (GRCm39) missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9,171,853 (GRCm39) missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9,180,381 (GRCm39) missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9,186,098 (GRCm39) missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9,190,474 (GRCm39) missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9,174,435 (GRCm39) intron probably benign
R0149:Dmtf1 UTSW 5 9,182,571 (GRCm39) missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9,182,454 (GRCm39) critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9,180,388 (GRCm39) missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9,177,987 (GRCm39) missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9,177,987 (GRCm39) missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9,186,109 (GRCm39) missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9,190,383 (GRCm39) splice site probably null
R1478:Dmtf1 UTSW 5 9,171,404 (GRCm39) missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9,190,384 (GRCm39) critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9,170,347 (GRCm39) splice site probably null
R1898:Dmtf1 UTSW 5 9,178,091 (GRCm39) missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9,198,989 (GRCm39) missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9,198,989 (GRCm39) missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9,179,323 (GRCm39) missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9,179,316 (GRCm39) missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9,182,454 (GRCm39) intron probably benign
R4467:Dmtf1 UTSW 5 9,186,085 (GRCm39) missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9,190,379 (GRCm39) intron probably benign
R4491:Dmtf1 UTSW 5 9,190,379 (GRCm39) intron probably benign
R5007:Dmtf1 UTSW 5 9,172,439 (GRCm39) unclassified probably benign
R5173:Dmtf1 UTSW 5 9,190,356 (GRCm39) intron probably benign
R5184:Dmtf1 UTSW 5 9,176,641 (GRCm39) missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9,174,515 (GRCm39) missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9,172,415 (GRCm39) unclassified probably benign
R5977:Dmtf1 UTSW 5 9,190,451 (GRCm39) missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9,176,656 (GRCm39) missense probably benign
R6887:Dmtf1 UTSW 5 9,187,149 (GRCm39) missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9,180,654 (GRCm39) intron probably benign
R7242:Dmtf1 UTSW 5 9,199,016 (GRCm39) missense possibly damaging 0.90
R7706:Dmtf1 UTSW 5 9,174,489 (GRCm39) missense possibly damaging 0.86
R7721:Dmtf1 UTSW 5 9,176,564 (GRCm39) missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9,190,453 (GRCm39) missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9,172,457 (GRCm39) unclassified probably benign
R7859:Dmtf1 UTSW 5 9,178,044 (GRCm39) missense probably damaging 1.00
R7883:Dmtf1 UTSW 5 9,190,397 (GRCm39) missense probably benign 0.35
R7975:Dmtf1 UTSW 5 9,179,169 (GRCm39) missense probably damaging 1.00
R8269:Dmtf1 UTSW 5 9,182,500 (GRCm39) nonsense probably null
R8479:Dmtf1 UTSW 5 9,170,428 (GRCm39) missense probably damaging 0.97
R8782:Dmtf1 UTSW 5 9,179,168 (GRCm39) missense probably damaging 1.00
R9296:Dmtf1 UTSW 5 9,190,467 (GRCm39) missense probably benign 0.01
R9359:Dmtf1 UTSW 5 9,171,927 (GRCm39) missense possibly damaging 0.73
R9372:Dmtf1 UTSW 5 9,190,399 (GRCm39) missense possibly damaging 0.86
R9403:Dmtf1 UTSW 5 9,171,927 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGCTTTGGGCATTACAGAGCAC -3'
(R):5'- GCAGTTGAGCACCTTGTTGCAC -3'

Sequencing Primer
(F):5'- AGCCTGCCATAATGGCCTTT -3'
(R):5'- TCCTGTCACCTATAGTATGAGGAG -3'
Posted On 2013-11-08