Incidental Mutation 'R0974:Vmn2r53'
ID 83014
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12335319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 114 (F114L)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118665
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: F114L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: F114L

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1102:Vmn2r53 UTSW 7 12,332,410 (GRCm39) missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12,335,366 (GRCm39) missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6312:Vmn2r53 UTSW 7 12,332,566 (GRCm39) critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12,315,513 (GRCm39) nonsense probably null
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12,340,418 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGATACTCAATGCACACACCAG -3'
(R):5'- TGCCAGAGCATGATGTTCAAGTCC -3'

Sequencing Primer
(F):5'- AGCTGGGGTCAACATCTGTG -3'
(R):5'- gagaggaagccagaagcag -3'
Posted On 2013-11-08