Incidental Mutation 'R0974:Chd2'
ID 83017
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Name chromodomain helicase DNA binding protein 2
Synonyms 5630401D06Rik, 2810013C04Rik, 2810040A01Rik
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R0974 (G1)
Quality Score 217
Status Not validated
Chromosome 7
Chromosomal Location 73076400-73191494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73128412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 858 (S858P)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
AlphaFold E9PZM4
Predicted Effect probably damaging
Transcript: ENSMUST00000169922
AA Change: S858P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: S858P

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199831
Predicted Effect unknown
Transcript: ENSMUST00000200423
AA Change: S37P
Meta Mutation Damage Score 0.9280 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73,118,325 (GRCm39) missense probably damaging 0.99
IGL00535:Chd2 APN 7 73,190,576 (GRCm39) missense probably benign 0.01
IGL00961:Chd2 APN 7 73,093,997 (GRCm39) missense probably damaging 0.99
IGL01092:Chd2 APN 7 73,091,434 (GRCm39) missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73,091,375 (GRCm39) splice site probably null
IGL02083:Chd2 APN 7 73,130,816 (GRCm39) missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73,091,465 (GRCm39) missense probably benign 0.01
IGL02243:Chd2 APN 7 73,147,456 (GRCm39) splice site probably null
IGL02385:Chd2 APN 7 73,085,570 (GRCm39) missense probably damaging 1.00
IGL02552:Chd2 APN 7 73,097,068 (GRCm39) unclassified probably benign
IGL02590:Chd2 APN 7 73,102,948 (GRCm39) missense probably benign 0.00
IGL02684:Chd2 APN 7 73,125,097 (GRCm39) missense probably damaging 0.99
IGL02731:Chd2 APN 7 73,143,204 (GRCm39) missense probably damaging 0.99
IGL03272:Chd2 APN 7 73,102,914 (GRCm39) missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73,151,852 (GRCm39) missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73,130,716 (GRCm39) missense probably benign
F6893:Chd2 UTSW 7 73,157,620 (GRCm39) missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0068:Chd2 UTSW 7 73,134,282 (GRCm39) missense probably damaging 1.00
R0763:Chd2 UTSW 7 73,097,022 (GRCm39) missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R1223:Chd2 UTSW 7 73,134,265 (GRCm39) missense probably damaging 1.00
R1435:Chd2 UTSW 7 73,102,884 (GRCm39) missense probably damaging 0.99
R1527:Chd2 UTSW 7 73,140,362 (GRCm39) nonsense probably null
R1599:Chd2 UTSW 7 73,122,799 (GRCm39) missense probably benign 0.05
R1657:Chd2 UTSW 7 73,130,178 (GRCm39) missense probably damaging 1.00
R1932:Chd2 UTSW 7 73,104,193 (GRCm39) missense probably damaging 0.99
R2110:Chd2 UTSW 7 73,079,735 (GRCm39) missense probably benign 0.00
R2202:Chd2 UTSW 7 73,128,416 (GRCm39) missense probably benign 0.00
R2383:Chd2 UTSW 7 73,153,168 (GRCm39) missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73,157,631 (GRCm39) missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73,118,238 (GRCm39) missense probably benign 0.35
R3713:Chd2 UTSW 7 73,121,538 (GRCm39) unclassified probably benign
R3788:Chd2 UTSW 7 73,096,878 (GRCm39) unclassified probably benign
R3826:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73,114,143 (GRCm39) splice site probably benign
R4093:Chd2 UTSW 7 73,150,764 (GRCm39) missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73,085,709 (GRCm39) missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73,190,622 (GRCm39) intron probably benign
R4782:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4792:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4799:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73,151,873 (GRCm39) missense probably damaging 1.00
R5055:Chd2 UTSW 7 73,130,256 (GRCm39) missense probably damaging 1.00
R5071:Chd2 UTSW 7 73,079,437 (GRCm39) missense probably benign 0.03
R5328:Chd2 UTSW 7 73,113,429 (GRCm39) missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73,122,833 (GRCm39) missense probably damaging 1.00
R5643:Chd2 UTSW 7 73,134,232 (GRCm39) missense probably damaging 1.00
R5666:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5670:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5706:Chd2 UTSW 7 73,141,105 (GRCm39) missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73,134,350 (GRCm39) splice site probably null
R5834:Chd2 UTSW 7 73,128,463 (GRCm39) missense probably damaging 1.00
R5920:Chd2 UTSW 7 73,187,060 (GRCm39) missense probably damaging 0.97
R6051:Chd2 UTSW 7 73,085,590 (GRCm39) missense probably benign 0.00
R6179:Chd2 UTSW 7 73,094,071 (GRCm39) missense probably damaging 0.98
R6229:Chd2 UTSW 7 73,101,471 (GRCm39) missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73,113,419 (GRCm39) missense probably damaging 0.99
R6310:Chd2 UTSW 7 73,102,912 (GRCm39) missense probably damaging 1.00
R6439:Chd2 UTSW 7 73,130,154 (GRCm39) missense probably damaging 1.00
R6444:Chd2 UTSW 7 73,150,785 (GRCm39) critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73,153,191 (GRCm39) missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73,143,313 (GRCm39) missense probably damaging 0.99
R6661:Chd2 UTSW 7 73,140,230 (GRCm39) missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73,125,127 (GRCm39) nonsense probably null
R6860:Chd2 UTSW 7 73,147,558 (GRCm39) missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73,125,171 (GRCm39) missense probably damaging 1.00
R6984:Chd2 UTSW 7 73,134,159 (GRCm39) nonsense probably null
R7095:Chd2 UTSW 7 73,121,629 (GRCm39) missense probably damaging 1.00
R7121:Chd2 UTSW 7 73,119,418 (GRCm39) missense probably benign 0.00
R7179:Chd2 UTSW 7 73,125,168 (GRCm39) missense probably damaging 1.00
R7500:Chd2 UTSW 7 73,101,556 (GRCm39) missense probably damaging 1.00
R7615:Chd2 UTSW 7 73,091,390 (GRCm39) missense probably damaging 0.97
R7646:Chd2 UTSW 7 73,085,521 (GRCm39) missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73,121,567 (GRCm39) missense probably null 1.00
R7898:Chd2 UTSW 7 73,169,223 (GRCm39) critical splice donor site probably null
R7935:Chd2 UTSW 7 73,149,373 (GRCm39) missense probably benign 0.01
R8033:Chd2 UTSW 7 73,085,628 (GRCm39) missense probably damaging 1.00
R8070:Chd2 UTSW 7 73,101,506 (GRCm39) missense probably benign
R8071:Chd2 UTSW 7 73,187,132 (GRCm39) missense probably benign
R8188:Chd2 UTSW 7 73,079,504 (GRCm39) nonsense probably null
R8196:Chd2 UTSW 7 73,118,285 (GRCm39) missense probably benign 0.00
R8258:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8259:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8357:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8457:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8778:Chd2 UTSW 7 73,079,483 (GRCm39) missense possibly damaging 0.88
R8816:Chd2 UTSW 7 73,140,245 (GRCm39) missense probably damaging 1.00
R8875:Chd2 UTSW 7 73,151,783 (GRCm39) missense probably damaging 1.00
R8935:Chd2 UTSW 7 73,153,210 (GRCm39) missense possibly damaging 0.47
R9005:Chd2 UTSW 7 73,134,294 (GRCm39) missense probably damaging 0.98
R9009:Chd2 UTSW 7 73,143,192 (GRCm39) missense probably benign 0.39
R9009:Chd2 UTSW 7 73,140,402 (GRCm39) missense probably benign 0.12
R9021:Chd2 UTSW 7 73,091,393 (GRCm39) missense probably benign 0.03
R9038:Chd2 UTSW 7 73,105,358 (GRCm39) missense probably damaging 1.00
R9064:Chd2 UTSW 7 73,143,279 (GRCm39) missense possibly damaging 0.70
R9383:Chd2 UTSW 7 73,098,918 (GRCm39) missense probably null 1.00
R9501:Chd2 UTSW 7 73,130,294 (GRCm39) missense probably damaging 1.00
R9501:Chd2 UTSW 7 73,091,481 (GRCm39) missense possibly damaging 0.92
R9550:Chd2 UTSW 7 73,119,439 (GRCm39) missense probably damaging 0.99
R9583:Chd2 UTSW 7 73,130,230 (GRCm39) missense probably damaging 0.99
R9665:Chd2 UTSW 7 73,079,555 (GRCm39) missense probably benign 0.00
RF009:Chd2 UTSW 7 73,169,410 (GRCm39) missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73,157,585 (GRCm39) missense probably benign 0.11
Z1177:Chd2 UTSW 7 73,118,334 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CATGCTTGCCCAGTGAGGAACAAC -3'
(R):5'- ACACATACCTTCAGAGCCCTTTGCC -3'

Sequencing Primer
(F):5'- CAAAACCAGGCATCTTTTAGAATAGG -3'
(R):5'- CCCAGTTATTTTTACTCAGTGAAGTC -3'
Posted On 2013-11-08