Incidental Mutation 'R0974:AI429214'
ID 83023
Institutional Source Beutler Lab
Gene Symbol AI429214
Ensembl Gene ENSMUSG00000074384
Gene Name expressed sequence AI429214
Synonyms
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 37460758-37462687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37461473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 207 (Q207R)
Ref Sequence ENSEMBL: ENSMUSP00000096424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098825]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000098825
AA Change: Q207R

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096424
Gene: ENSMUSG00000074384
AA Change: Q207R

DomainStartEndE-ValueType
low complexity region 72 86 N/A INTRINSIC
Pfam:DUF4606 175 277 3.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209814
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in AI429214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:AI429214 APN 8 37,461,383 (GRCm39) missense probably damaging 0.98
IGL02508:AI429214 APN 8 37,461,240 (GRCm39) missense probably benign
R0973:AI429214 UTSW 8 37,461,473 (GRCm39) missense probably benign 0.29
R0973:AI429214 UTSW 8 37,461,473 (GRCm39) missense probably benign 0.29
R2007:AI429214 UTSW 8 37,460,923 (GRCm39) missense probably benign 0.29
R2113:AI429214 UTSW 8 37,461,154 (GRCm39) nonsense probably null
R2126:AI429214 UTSW 8 37,461,362 (GRCm39) missense probably benign 0.00
R2254:AI429214 UTSW 8 37,460,920 (GRCm39) missense possibly damaging 0.91
R3409:AI429214 UTSW 8 37,461,071 (GRCm39) missense probably benign 0.00
R3411:AI429214 UTSW 8 37,461,071 (GRCm39) missense probably benign 0.00
R3852:AI429214 UTSW 8 37,461,596 (GRCm39) missense probably damaging 1.00
R4657:AI429214 UTSW 8 37,461,545 (GRCm39) missense probably damaging 1.00
R5766:AI429214 UTSW 8 37,461,383 (GRCm39) frame shift probably null
R5767:AI429214 UTSW 8 37,461,383 (GRCm39) frame shift probably null
R6248:AI429214 UTSW 8 37,461,278 (GRCm39) missense probably damaging 1.00
R6888:AI429214 UTSW 8 37,460,987 (GRCm39) missense possibly damaging 0.85
R8018:AI429214 UTSW 8 37,460,820 (GRCm39) start gained probably benign
R8817:AI429214 UTSW 8 37,461,268 (GRCm39) missense probably benign 0.05
R8985:AI429214 UTSW 8 37,460,820 (GRCm39) start gained probably benign
R9564:AI429214 UTSW 8 37,461,067 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATCCGCAGAAGAACTGGATGCC -3'
(R):5'- AAGCCCTGATGTGCTTCTCCAAC -3'

Sequencing Primer
(F):5'- GTAAACTTGATTCACCAGAGACAG -3'
(R):5'- ATGTGCTTCTCCAACACGGG -3'
Posted On 2013-11-08