Incidental Mutation 'R0974:Snx14'
ID 83027
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Name sorting nexin 14
Synonyms YR-14, C330035N22Rik
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 88258805-88320982 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88282774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806] [ENSMUST00000174806]
AlphaFold Q8BHY8
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140439
Predicted Effect probably benign
Transcript: ENSMUST00000165315
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173011
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173039
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174806
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174806
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88,284,243 (GRCm39) missense probably damaging 0.99
IGL00773:Snx14 APN 9 88,276,592 (GRCm39) missense probably damaging 0.96
IGL00847:Snx14 APN 9 88,302,382 (GRCm39) missense probably damaging 1.00
IGL01526:Snx14 APN 9 88,263,553 (GRCm39) missense probably damaging 0.99
IGL01662:Snx14 APN 9 88,267,891 (GRCm39) splice site probably benign
IGL01928:Snx14 APN 9 88,263,565 (GRCm39) missense probably benign 0.04
IGL02225:Snx14 APN 9 88,295,577 (GRCm39) missense probably damaging 0.99
IGL02498:Snx14 APN 9 88,289,517 (GRCm39) missense probably damaging 1.00
IGL02585:Snx14 APN 9 88,286,571 (GRCm39) missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88,285,356 (GRCm39) missense probably damaging 1.00
IGL03073:Snx14 APN 9 88,304,949 (GRCm39) critical splice donor site probably null
R0167:Snx14 UTSW 9 88,289,469 (GRCm39) missense probably damaging 1.00
R0324:Snx14 UTSW 9 88,287,291 (GRCm39) critical splice donor site probably null
R0627:Snx14 UTSW 9 88,276,483 (GRCm39) missense probably benign
R0862:Snx14 UTSW 9 88,266,049 (GRCm39) missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88,266,049 (GRCm39) missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88,282,774 (GRCm39) critical splice donor site probably null
R0973:Snx14 UTSW 9 88,282,774 (GRCm39) critical splice donor site probably null
R1478:Snx14 UTSW 9 88,276,581 (GRCm39) missense probably benign 0.00
R1511:Snx14 UTSW 9 88,280,417 (GRCm39) nonsense probably null
R1522:Snx14 UTSW 9 88,284,277 (GRCm39) missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88,258,958 (GRCm39) missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88,289,543 (GRCm39) splice site probably benign
R1634:Snx14 UTSW 9 88,267,792 (GRCm39) missense probably benign 0.00
R1704:Snx14 UTSW 9 88,295,591 (GRCm39) missense probably damaging 1.00
R1713:Snx14 UTSW 9 88,297,728 (GRCm39) missense probably damaging 1.00
R1883:Snx14 UTSW 9 88,284,314 (GRCm39) missense probably benign 0.01
R3701:Snx14 UTSW 9 88,302,296 (GRCm39) splice site probably benign
R3853:Snx14 UTSW 9 88,289,372 (GRCm39) splice site probably benign
R4301:Snx14 UTSW 9 88,292,676 (GRCm39) missense probably damaging 1.00
R4449:Snx14 UTSW 9 88,305,052 (GRCm39) missense probably benign 0.05
R4793:Snx14 UTSW 9 88,276,495 (GRCm39) missense probably damaging 0.98
R4934:Snx14 UTSW 9 88,280,341 (GRCm39) missense probably damaging 0.98
R5126:Snx14 UTSW 9 88,264,152 (GRCm39) missense probably damaging 1.00
R5227:Snx14 UTSW 9 88,280,347 (GRCm39) missense possibly damaging 0.77
R5518:Snx14 UTSW 9 88,265,855 (GRCm39) missense probably damaging 1.00
R5838:Snx14 UTSW 9 88,273,829 (GRCm39) missense probably damaging 1.00
R5957:Snx14 UTSW 9 88,285,327 (GRCm39) missense possibly damaging 0.84
R6153:Snx14 UTSW 9 88,273,859 (GRCm39) missense probably damaging 1.00
R6156:Snx14 UTSW 9 88,289,392 (GRCm39) missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88,304,967 (GRCm39) missense probably damaging 0.96
R6784:Snx14 UTSW 9 88,263,845 (GRCm39) missense probably benign 0.01
R6823:Snx14 UTSW 9 88,276,435 (GRCm39) missense possibly damaging 0.90
R6837:Snx14 UTSW 9 88,262,276 (GRCm39) missense probably benign 0.07
R7169:Snx14 UTSW 9 88,280,362 (GRCm39) missense probably damaging 0.98
R7216:Snx14 UTSW 9 88,263,844 (GRCm39) missense probably damaging 0.99
R7224:Snx14 UTSW 9 88,276,614 (GRCm39) missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88,286,369 (GRCm39) missense possibly damaging 0.49
R7738:Snx14 UTSW 9 88,289,527 (GRCm39) missense probably benign 0.00
R7743:Snx14 UTSW 9 88,280,402 (GRCm39) missense probably benign 0.01
R7969:Snx14 UTSW 9 88,295,613 (GRCm39) missense probably damaging 1.00
R8016:Snx14 UTSW 9 88,297,740 (GRCm39) missense probably damaging 0.99
R8384:Snx14 UTSW 9 88,285,333 (GRCm39) nonsense probably null
R8492:Snx14 UTSW 9 88,263,869 (GRCm39) missense possibly damaging 0.94
R8686:Snx14 UTSW 9 88,297,746 (GRCm39) missense probably damaging 1.00
R8738:Snx14 UTSW 9 88,289,453 (GRCm39) missense possibly damaging 0.93
R8870:Snx14 UTSW 9 88,295,541 (GRCm39) missense probably benign 0.01
R9208:Snx14 UTSW 9 88,265,832 (GRCm39) missense probably benign 0.01
R9402:Snx14 UTSW 9 88,289,490 (GRCm39) missense probably damaging 1.00
R9620:Snx14 UTSW 9 88,263,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATTATTCAGCAGCCCTCCTTATCCC -3'
(R):5'- AGTCTCTCTGTGTTGTGCTGTACCA -3'

Sequencing Primer
(F):5'- cacacttttcatcccagcac -3'
(R):5'- TACCACATGGTACATCTAAGGAAAAG -3'
Posted On 2013-11-08