Mutagenetix > Incidental Mutation

Incidental Mutation 'R0974:Golga4'

83028

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

039103-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118537273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 365 (I365T)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: I365T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: I365T

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

unknown
Transcript: ENSMUST00000212183
AA Change: I40T

Predicted Effect

probably damaging
Transcript: ENSMUST00000212461
AA Change: I374T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.1613

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.5%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
Atp6v0a1	T	A	11: 101,055,491	L770*	probably null	Het
B3gnt5	T	A	16: 19,770,010	D326E	probably damaging	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Dnah9	A	T	11: 66,005,837		probably null	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Taf2	GCTTCTTCTTCTTCTTCTT	GCTTCTTCTTCTTCTT	15: 55,016,461		probably benign	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Usp24	T	A	4: 106,371,079	Y780*	probably null	Het
Usp24	A	G	4: 106,413,678		probably null	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGAGTGTGTGAAGCCAGATCAGC -3'
(R):5'- GCAGTCTTAACCGAGACGGGTATG -3'

Sequencing Primer
(F):5'- CCAAGTGCTCTGGGTCTATAGC -3'
(R):5'- TGTCTATGGCAGAGCACTGAC -3'

Posted On

2013-11-08