Incidental Mutation 'R0974:Efemp1'
ID 83030
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Name epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 28803204-28876743 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28804538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 22 (E22G)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
AlphaFold Q8BPB5
Predicted Effect probably damaging
Transcript: ENSMUST00000020759
AA Change: E22G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: E22G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Meta Mutation Damage Score 0.2792 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28,876,223 (GRCm39) missense probably benign 0.32
IGL01862:Efemp1 APN 11 28,871,428 (GRCm39) missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28,866,971 (GRCm39) critical splice donor site probably null
IGL03175:Efemp1 APN 11 28,876,259 (GRCm39) missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28,876,218 (GRCm39) missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28,804,538 (GRCm39) missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28,804,538 (GRCm39) missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28,866,942 (GRCm39) missense probably benign 0.00
R1701:Efemp1 UTSW 11 28,871,750 (GRCm39) missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28,871,442 (GRCm39) missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28,871,613 (GRCm39) missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28,871,613 (GRCm39) missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28,864,696 (GRCm39) missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28,864,696 (GRCm39) missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28,864,696 (GRCm39) missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28,865,763 (GRCm39) missense probably damaging 1.00
R2396:Efemp1 UTSW 11 28,817,941 (GRCm39) missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28,871,795 (GRCm39) missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28,876,241 (GRCm39) missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28,864,590 (GRCm39) missense probably benign 0.05
R5297:Efemp1 UTSW 11 28,817,868 (GRCm39) missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28,817,758 (GRCm39) missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28,871,418 (GRCm39) missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28,871,760 (GRCm39) missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28,871,760 (GRCm39) missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28,864,603 (GRCm39) missense probably benign 0.12
R7067:Efemp1 UTSW 11 28,817,926 (GRCm39) missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28,817,501 (GRCm39) missense possibly damaging 0.92
R8223:Efemp1 UTSW 11 28,804,528 (GRCm39) missense probably benign 0.13
R8243:Efemp1 UTSW 11 28,871,690 (GRCm39) missense probably damaging 0.99
R8279:Efemp1 UTSW 11 28,871,795 (GRCm39) missense possibly damaging 0.52
R8313:Efemp1 UTSW 11 28,860,691 (GRCm39) missense probably benign 0.39
R8378:Efemp1 UTSW 11 28,871,765 (GRCm39) missense probably damaging 0.98
Z1177:Efemp1 UTSW 11 28,817,909 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAATAGACAGATGCTGCGCCCC -3'
(R):5'- AGACCCAGCACGATTTACCAGGAG -3'

Sequencing Primer
(F):5'- TGTGGTATAAACACACGCTGAAC -3'
(R):5'- GATTTACCAGGAGTCCTAAACCTGAG -3'
Posted On 2013-11-08