Incidental Mutation 'R0974:Slc38a4'
ID83046
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Namesolute carrier family 38, member 4
Synonyms1700012A18Rik, Ata3, 1110012E16Rik
MMRRC Submission 039103-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R0974 (G1)
Quality Score171
Status Not validated
Chromosome15
Chromosomal Location96994820-97055956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97005858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 421 (V421M)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000231039]
Predicted Effect probably benign
Transcript: ENSMUST00000023101
AA Change: V421M

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: V421M

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166223
AA Change: V421M

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: V421M

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230086
AA Change: V421M

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000231039
AA Change: V421M

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Dnah9 A T 11: 66,005,837 probably null Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Usp24 A G 4: 106,413,678 probably null Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 97019809 missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96999494 missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96999516 missense probably benign 0.05
IGL01951:Slc38a4 APN 15 97019763 missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 97008949 missense probably benign 0.00
R0304:Slc38a4 UTSW 15 97008454 missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 97016839 missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R1340:Slc38a4 UTSW 15 97010272 splice site probably benign
R1973:Slc38a4 UTSW 15 96999597 missense probably benign 0.36
R2058:Slc38a4 UTSW 15 97008725 missense probably benign 0.22
R2083:Slc38a4 UTSW 15 97008993 missense probably benign 0.00
R2108:Slc38a4 UTSW 15 97008997 missense probably benign
R3908:Slc38a4 UTSW 15 97012994 critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96997042 missense probably benign 0.03
R4259:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4260:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 97009084 missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 97009018 missense probably benign
R5289:Slc38a4 UTSW 15 97010348 missense possibly damaging 0.72
R5638:Slc38a4 UTSW 15 97012990 missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96999551 missense probably benign 0.23
R7059:Slc38a4 UTSW 15 97009014 nonsense probably null
R7223:Slc38a4 UTSW 15 97010345 missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 97005900 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAGCGAGcagaggtcctgaatt -3'
(R):5'- TTTCTGAGCTGTCTGAAGGCCCA -3'

Sequencing Primer
(F):5'- cccagcaatcacacgataac -3'
(R):5'- TGTTACTGCTACACGCTTCTG -3'
Posted On2013-11-08