Incidental Mutation 'R0974:B3gnt5'
ID 83048
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.525) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 19578958-19591503 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19588760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 326 (D326E)
Ref Sequence ENSEMBL: ENSMUSP00000126157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
AlphaFold Q8BGY6
Predicted Effect probably damaging
Transcript: ENSMUST00000079780
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: D326E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119468
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: D326E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121344
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: D326E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152845
Predicted Effect probably damaging
Transcript: ENSMUST00000164397
AA Change: D326E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: D326E

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Meta Mutation Damage Score 0.3207 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19,587,963 (GRCm39) missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19,588,531 (GRCm39) missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19,588,360 (GRCm39) missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19,588,744 (GRCm39) missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19,587,903 (GRCm39) missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19,588,801 (GRCm39) missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19,587,850 (GRCm39) missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19,588,760 (GRCm39) missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19,588,760 (GRCm39) missense probably damaging 1.00
R1034:B3gnt5 UTSW 16 19,588,234 (GRCm39) missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19,587,924 (GRCm39) missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19,588,617 (GRCm39) missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19,588,364 (GRCm39) missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19,588,294 (GRCm39) missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19,587,798 (GRCm39) missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19,587,798 (GRCm39) missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19,588,632 (GRCm39) missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19,587,894 (GRCm39) missense probably benign
R4987:B3gnt5 UTSW 16 19,587,952 (GRCm39) missense probably damaging 1.00
R5027:B3gnt5 UTSW 16 19,588,444 (GRCm39) missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19,588,759 (GRCm39) missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19,588,740 (GRCm39) missense probably damaging 1.00
R7224:B3gnt5 UTSW 16 19,588,503 (GRCm39) missense probably benign 0.06
R7261:B3gnt5 UTSW 16 19,588,123 (GRCm39) missense probably damaging 1.00
R7369:B3gnt5 UTSW 16 19,588,410 (GRCm39) missense probably benign 0.00
R8818:B3gnt5 UTSW 16 19,588,347 (GRCm39) missense possibly damaging 0.53
Z1176:B3gnt5 UTSW 16 19,588,560 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTCCTGTTAGGGATAAAAGCAGC -3'
(R):5'- CAAATGCAGCCCAACAAGGGTATG -3'

Sequencing Primer
(F):5'- TCTATGAGGCATCGCAGAC -3'
(R):5'- CCAACAAGGGTATGAATTCCTG -3'
Posted On 2013-11-08