Incidental Mutation 'R0974:Btbd9'
ID 83049
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene Name BTB domain containing 9
Synonyms 1700023F20Rik
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30434498-30795462 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30518607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 451 (D451V)
Ref Sequence ENSEMBL: ENSMUSP00000127300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
AlphaFold Q8C726
Predicted Effect probably damaging
Transcript: ENSMUST00000079924
AA Change: D451V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: D451V

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168787
AA Change: D451V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: D451V

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Meta Mutation Damage Score 0.8723 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30,518,575 (GRCm39) missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30,439,391 (GRCm39) missense unknown
IGL01814:Btbd9 APN 17 30,518,509 (GRCm39) missense probably benign 0.01
IGL01820:Btbd9 APN 17 30,746,383 (GRCm39) missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30,736,124 (GRCm39) missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30,493,910 (GRCm39) nonsense probably null
IGL02390:Btbd9 APN 17 30,743,788 (GRCm39) missense probably benign 0.22
IGL02414:Btbd9 APN 17 30,439,533 (GRCm39) missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30,553,271 (GRCm39) missense possibly damaging 0.81
crumbs UTSW 17 30,518,710 (GRCm39) splice site probably null
grain UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30,749,188 (GRCm39) missense probably damaging 0.96
R0023:Btbd9 UTSW 17 30,749,188 (GRCm39) missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0134:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0427:Btbd9 UTSW 17 30,493,916 (GRCm39) missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30,749,191 (GRCm39) missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30,743,941 (GRCm39) missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30,518,607 (GRCm39) missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30,518,607 (GRCm39) missense probably damaging 0.99
R1061:Btbd9 UTSW 17 30,746,409 (GRCm39) missense probably benign 0.00
R1763:Btbd9 UTSW 17 30,553,271 (GRCm39) missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30,732,567 (GRCm39) missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30,749,202 (GRCm39) missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30,493,904 (GRCm39) missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30,746,320 (GRCm39) missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30,553,302 (GRCm39) missense probably benign
R3684:Btbd9 UTSW 17 30,553,281 (GRCm39) missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30,732,633 (GRCm39) missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30,704,906 (GRCm39) intron probably benign
R4492:Btbd9 UTSW 17 30,746,545 (GRCm39) missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30,704,561 (GRCm39) intron probably benign
R4854:Btbd9 UTSW 17 30,743,839 (GRCm39) missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30,447,842 (GRCm39) missense probably benign 0.16
R5963:Btbd9 UTSW 17 30,553,192 (GRCm39) splice site probably null
R6295:Btbd9 UTSW 17 30,518,710 (GRCm39) splice site probably null
R6422:Btbd9 UTSW 17 30,749,230 (GRCm39) missense probably benign
R7023:Btbd9 UTSW 17 30,746,546 (GRCm39) missense probably benign 0.02
R7826:Btbd9 UTSW 17 30,553,301 (GRCm39) missense probably benign 0.42
R7922:Btbd9 UTSW 17 30,493,858 (GRCm39) missense probably benign 0.01
R7962:Btbd9 UTSW 17 30,736,177 (GRCm39) missense probably damaging 0.99
R8265:Btbd9 UTSW 17 30,553,278 (GRCm39) missense possibly damaging 0.86
R8786:Btbd9 UTSW 17 30,749,144 (GRCm39) missense probably damaging 0.97
R9541:Btbd9 UTSW 17 30,439,438 (GRCm39) missense possibly damaging 0.96
R9591:Btbd9 UTSW 17 30,736,222 (GRCm39) missense probably damaging 1.00
R9703:Btbd9 UTSW 17 30,749,200 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGTGGACAGCGAGTACCATTGCC -3'
(R):5'- TGGAATGTGCAAAGCCCCAGAAAC -3'

Sequencing Primer
(F):5'- GAGTACCATTGCCCTGCC -3'
(R):5'- GGAAATCCATCTGACCTGCTAGATAG -3'
Posted On 2013-11-08