Incidental Mutation 'R0974:Pkd2l2'
ID 83051
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Name polycystic kidney disease 2-like 2
Synonyms Polycystin - L2, TRPP5
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34541553-34575842 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34561305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 438 (T438A)
Ref Sequence ENSEMBL: ENSMUSP00000127257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000166156]
AlphaFold Q9JLG4
Predicted Effect probably damaging
Transcript: ENSMUST00000014647
AA Change: T438A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: T438A

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166156
AA Change: T438A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: T438A

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Meta Mutation Damage Score 0.5717 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34,550,068 (GRCm39) missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34,550,089 (GRCm39) missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34,568,421 (GRCm39) critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34,545,768 (GRCm39) nonsense probably null
IGL02480:Pkd2l2 APN 18 34,571,843 (GRCm39) missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34,549,970 (GRCm39) nonsense probably null
IGL02818:Pkd2l2 APN 18 34,545,862 (GRCm39) missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34,563,373 (GRCm39) missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34,558,142 (GRCm39) missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34,568,380 (GRCm39) missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34,558,155 (GRCm39) missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34,563,321 (GRCm39) splice site probably null
R0973:Pkd2l2 UTSW 18 34,561,305 (GRCm39) missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34,561,305 (GRCm39) missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34,571,269 (GRCm39) critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34,563,755 (GRCm39) missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34,560,446 (GRCm39) missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34,563,382 (GRCm39) missense probably damaging 1.00
R3695:Pkd2l2 UTSW 18 34,571,843 (GRCm39) missense possibly damaging 0.48
R4058:Pkd2l2 UTSW 18 34,561,245 (GRCm39) missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34,571,254 (GRCm39) missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34,542,889 (GRCm39) nonsense probably null
R4652:Pkd2l2 UTSW 18 34,542,889 (GRCm39) nonsense probably null
R5114:Pkd2l2 UTSW 18 34,566,355 (GRCm39) missense probably benign
R5341:Pkd2l2 UTSW 18 34,542,987 (GRCm39) splice site probably null
R5686:Pkd2l2 UTSW 18 34,558,290 (GRCm39) missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34,563,826 (GRCm39) missense probably benign
R6061:Pkd2l2 UTSW 18 34,563,742 (GRCm39) missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34,561,297 (GRCm39) missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34,547,733 (GRCm39) missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34,560,497 (GRCm39) missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34,571,824 (GRCm39) missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34,558,134 (GRCm39) missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34,571,210 (GRCm39) missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34,549,936 (GRCm39) missense probably benign 0.02
R6958:Pkd2l2 UTSW 18 34,542,543 (GRCm39) nonsense probably null
R7052:Pkd2l2 UTSW 18 34,558,212 (GRCm39) missense possibly damaging 0.90
R7695:Pkd2l2 UTSW 18 34,561,298 (GRCm39) missense possibly damaging 0.77
R7763:Pkd2l2 UTSW 18 34,566,340 (GRCm39) critical splice acceptor site probably null
R7777:Pkd2l2 UTSW 18 34,549,913 (GRCm39) missense probably damaging 1.00
R7944:Pkd2l2 UTSW 18 34,560,481 (GRCm39) missense possibly damaging 0.90
R8003:Pkd2l2 UTSW 18 34,561,232 (GRCm39) missense probably damaging 1.00
R8468:Pkd2l2 UTSW 18 34,560,464 (GRCm39) missense possibly damaging 0.88
R8482:Pkd2l2 UTSW 18 34,558,166 (GRCm39) missense possibly damaging 0.52
R8729:Pkd2l2 UTSW 18 34,566,354 (GRCm39) missense probably benign
R8894:Pkd2l2 UTSW 18 34,571,273 (GRCm39) splice site probably benign
R9336:Pkd2l2 UTSW 18 34,561,158 (GRCm39) missense probably damaging 1.00
R9408:Pkd2l2 UTSW 18 34,563,383 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAACGCACTGACTCTTGCTC -3'
(R):5'- TGTAGCAAACGCTGATCCACTCTC -3'

Sequencing Primer
(F):5'- CCCTGTTGCTTTCAGATATTCAAG -3'
(R):5'- TCTGACTTGACCTACCAATGAC -3'
Posted On 2013-11-08