Incidental Mutation 'R0924:Atpaf1'
ID83062
Institutional Source Beutler Lab
Gene Symbol Atpaf1
Ensembl Gene ENSMUSG00000028710
Gene NameATP synthase mitochondrial F1 complex assembly factor 1
Synonyms6330547J17Rik, ATP11p, ATP11
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115784812-115818828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115795438 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 12 (V12D)
Ref Sequence ENSEMBL: ENSMUSP00000135741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137401] [ENSMUST00000175725] [ENSMUST00000176047] [ENSMUST00000176192] [ENSMUST00000177280]
Predicted Effect probably benign
Transcript: ENSMUST00000137401
SMART Domains Protein: ENSMUSP00000135490
Gene: ENSMUSG00000028710

DomainStartEndE-ValueType
Pfam:ATP11 1 60 4.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175725
AA Change: V54D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135073
Gene: ENSMUSG00000028710
AA Change: V54D

DomainStartEndE-ValueType
Pfam:ATP11 1 189 2.5e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176047
AA Change: V195D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135831
Gene: ENSMUSG00000028710
AA Change: V195D

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 91 329 2.7e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176192
AA Change: V12D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000177280
AA Change: V178D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135214
Gene: ENSMUSG00000028710
AA Change: V178D

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 89 212 7.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184179
AA Change: V117D
Meta Mutation Damage Score 0.9513 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Atpaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Atpaf1 APN 4 115791269 missense probably damaging 1.00
IGL03122:Atpaf1 APN 4 115791278 missense probably damaging 1.00
R0396:Atpaf1 UTSW 4 115785252 missense possibly damaging 0.58
R1462:Atpaf1 UTSW 4 115784953 unclassified probably benign
R1614:Atpaf1 UTSW 4 115796757 missense possibly damaging 0.52
R1637:Atpaf1 UTSW 4 115788302 missense probably benign 0.00
R2180:Atpaf1 UTSW 4 115788360 start codon destroyed probably null 0.03
R4290:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R4293:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R7291:Atpaf1 UTSW 4 115811091 missense probably damaging 1.00
R7423:Atpaf1 UTSW 4 115790630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTAGGATTTGGAGAGATGACTCA -3'
(R):5'- GCATTTGCCATACACACAGGGAGG -3'

Sequencing Primer
(F):5'- CTCAGGAGTGAAGAGAACTTTCTAGC -3'
(R):5'- AGAAAGCCATGCTGTGTCTC -3'
Posted On2013-11-08