Mutagenetix > Incidental Mutation

Incidental Mutation 'R0924:9530053A07Rik'

83079

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

039071-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R0924 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28140130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 456 (Y456F)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000059886
AA Change: Y456F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: Y456F

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130693

Predicted Effect

probably damaging
Transcript: ENSMUST00000150948
AA Change: Y456F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: Y456F

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Meta Mutation Damage Score

0.2614

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.2%

Validation Efficiency

97% (69/71)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,251,070		probably benign	Het
Adamts18	A	T	8: 113,705,396		probably null	Het
Ahcyl2	A	C	6: 29,870,628		probably null	Het
Ajap1	T	A	4: 153,386,472	I293F	probably damaging	Het
Akap10	T	C	11: 61,904,863		probably benign	Het
Aldh3b2	T	C	19: 3,979,350	V241A	probably benign	Het
Anxa6	A	T	11: 54,994,388		probably null	Het
Atpaf1	T	A	4: 115,795,438	V12D	probably damaging	Het
Aurkb	C	A	11: 69,045,996	Y12*	probably null	Het
Bicdl1	A	G	5: 115,661,528		probably benign	Het
Bnc1	A	T	7: 81,978,408		probably benign	Het
Bpi	A	G	2: 158,261,426	I114V	possibly damaging	Het
Cacna1c	A	T	6: 118,675,896	I772N	probably damaging	Het
Cacna2d1	A	G	5: 16,365,862	N1045D	possibly damaging	Het
Ccrl2	A	G	9: 111,055,968	V154A	probably benign	Het
Celsr3	C	A	9: 108,846,025	Q2831K	possibly damaging	Het
Cul3	A	T	1: 80,290,118	M102K	probably damaging	Het
Cwf19l2	T	C	9: 3,441,047		probably benign	Het
Dlg5	G	A	14: 24,135,577	P1920L	probably damaging	Het
Dnah2	T	C	11: 69,421,308	H4393R	probably damaging	Het
Eif2b3	T	A	4: 117,081,578	V408D	possibly damaging	Het
Eml3	T	C	19: 8,933,311		probably null	Het
Enpp2	T	C	15: 54,906,959		probably benign	Het
Gm14178	T	A	11: 99,747,500	T18S		Het
H2-Bl	A	T	17: 36,083,932	V33E	probably damaging	Het
H2-M11	A	G	17: 36,549,214	M324V	probably benign	Het
Hdac10	T	C	15: 89,125,862	T298A	probably benign	Het
Hepacam	A	C	9: 37,383,928		probably benign	Het
Hist1h2bk	G	A	13: 22,036,040	D52N	probably damaging	Het
Hmx3	A	T	7: 131,543,084	H41L	probably benign	Het
Ifi27l2a	A	G	12: 103,442,380	V68A	probably damaging	Het
Itga11	A	G	9: 62,776,674	E1079G	probably benign	Het
Krt6a	T	C	15: 101,690,800		probably benign	Het
L1td1	A	G	4: 98,737,625	N686D	probably damaging	Het
Lrrtm2	G	A	18: 35,213,755	R165C	probably damaging	Het
Macf1	G	T	4: 123,385,478	A3910E	probably damaging	Het
Muc5ac	A	T	7: 141,807,515	Y1521F	possibly damaging	Het
Myo7a	A	T	7: 98,098,256	I129N	probably damaging	Het
Ncam1	A	T	9: 49,562,176		probably benign	Het
Nckap1	A	T	2: 80,554,249	C114S	probably benign	Het
Nf1	T	G	11: 79,453,866	W1260G	probably damaging	Het
Olfr1415	A	G	1: 92,491,405	S117P	possibly damaging	Het
Olfr411	T	C	11: 74,346,798	Y262C	probably damaging	Het
Olfr813	A	T	10: 129,856,646	I43F	probably damaging	Het
Oxtr	A	T	6: 112,489,637		probably null	Het
Pabpc4	C	T	4: 123,294,665	R356C	possibly damaging	Het
Pcbp2	T	A	15: 102,489,762	D182E	probably damaging	Het
Pgm1	A	T	5: 64,112,147	I526F	possibly damaging	Het
Rab43	A	T	6: 87,792,770	Y151*	probably null	Het
Rbm19	A	G	5: 120,126,204	E343G	probably benign	Het
Rel	A	T	11: 23,742,439	D531E	probably benign	Het
Rfx4	T	A	10: 84,868,427	V262E	probably damaging	Het
Rnf31	T	C	14: 55,593,002		probably benign	Het
Robo3	T	A	9: 37,429,482		probably benign	Het
Ryr3	A	G	2: 112,841,833	L1431P	probably damaging	Het
Sema3d	A	C	5: 12,463,216	D51A	possibly damaging	Het
Sema6a	A	G	18: 47,248,492	L996P	probably damaging	Het
Sh2d4a	T	A	8: 68,335,123	F294I	probably damaging	Het
Sorl1	T	A	9: 42,008,174		probably benign	Het
Sox1ot	G	T	8: 12,430,455		noncoding transcript	Het
Spsb3	A	T	17: 24,891,384	N395I	probably damaging	Het
Sptan1	A	G	2: 30,016,028	N1662S	probably damaging	Het
Srd5a2	G	T	17: 74,024,521	N160K	probably damaging	Het
Tmem132d	G	A	5: 127,984,439		probably benign	Het
Tmem173	A	G	18: 35,735,101		probably null	Het
Unc80	A	T	1: 66,510,641	Q686L	possibly damaging	Het
Vmn2r93	A	G	17: 18,304,181	T146A	probably benign	Het
Wdr19	A	G	5: 65,256,439		probably benign	Het
Zfp646	C	T	7: 127,883,810	Q1500*	probably null	Het
Zfp683	T	C	4: 134,055,827	Y201H	probably benign	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28164528	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28154445	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28155318	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28139778	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28150702	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28140133	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28155324	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28153292	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28152796	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28137525	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28139856	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28146779	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28154635	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28157892	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28153370	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28162923	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28147188	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28164372	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28153722	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28142242	missense	probably damaging	0.99
herz	UTSW	7	28153839	missense	possibly damaging	0.72
pulse	UTSW	7	28153749	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28140130	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28154464	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28153412	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0132:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28156825	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28142274	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28140235	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28137340	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28153749	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28147465	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28159378	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28162690	missense	probably benign	0.30
R0586:9530053A07Rik	UTSW	7	28137091	missense	probably damaging	0.99
R0930:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28154520	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28157673	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28142794	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28159478	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28137157	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28157093	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28147110	missense	probably damaging	0.98
R1697:9530053A07Rik	UTSW	7	28154347	missense	probably damaging	1.00
R1741:9530053A07Rik	UTSW	7	28157854	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28155372	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28155546	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28154732	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28144348	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28131512	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28154360	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28155594	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28157535	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28158022	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28155474	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28131635	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28164307	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28154195	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28154555	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28157778	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28154294	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28152985	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28156897	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28137109	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28156648	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28154335	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28146906	missense	probably damaging	1.00
R4460:9530053A07Rik	UTSW	7	28152856	missense	probably benign	0.17
R4463:9530053A07Rik	UTSW	7	28150719	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28142800	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28156983	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28143924	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28156958	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28153308	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28140183	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28156914	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28157999	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28156569	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28142878	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28152852	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28137329	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28139959	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28150714	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28157592	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28144186	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28155373	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28144368	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28147135	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28152835	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28140183	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R7039:9530053A07Rik	UTSW	7	28140148	missense	possibly damaging	0.80
R7171:9530053A07Rik	UTSW	7	28154519	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28144408	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28140220	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28140279	missense	possibly damaging	0.79
R7344:9530053A07Rik	UTSW	7	28152760	missense	possibly damaging	0.46
R7392:9530053A07Rik	UTSW	7	28164372	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28140231	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28144256	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28154423	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28140045	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28147201	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28139965	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28157073	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28147496	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28153341	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28164448	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28147349	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28155360	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28142733	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28143921	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28143952	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28153839	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28154707	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28131581	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28154444	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28164326	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28155451	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28154431	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28154329	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28140094	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28156985	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28143856	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28152840	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28137466	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28142484	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28154380	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28137199	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28142301	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28156619	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28157010	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28142386	missense	probably benign	0.06
Z1176:9530053A07Rik	UTSW	7	28154762	missense	probably benign	0.03
Z1177:9530053A07Rik	UTSW	7	28139898	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28131572	missense	probably benign
Z1186:9530053A07Rik	UTSW	7	28146705	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28156986	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTCCAGCCAACAGCCACTATGAG -3'
(R):5'- GAATGAATCCCACTCTGCTTCCACC -3'

Sequencing Primer
(F):5'- TGGCCCCAGGTCAAGAAG -3'
(R):5'- ACCTCCAACTTGATTCCTAAGG -3'

Posted On

2013-11-08