Mutagenetix > Incidental Mutation

Incidental Mutation 'R0924:Sorl1'

83092

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

039071-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R0924 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 42008174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably benign
Transcript: ENSMUST00000060989

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.2%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,251,070		probably benign	Het
9530053A07Rik	A	T	7: 28,140,130	Y456F	probably damaging	Het
Adamts18	A	T	8: 113,705,396		probably null	Het
Ahcyl2	A	C	6: 29,870,628		probably null	Het
Ajap1	T	A	4: 153,386,472	I293F	probably damaging	Het
Akap10	T	C	11: 61,904,863		probably benign	Het
Aldh3b2	T	C	19: 3,979,350	V241A	probably benign	Het
Anxa6	A	T	11: 54,994,388		probably null	Het
Atpaf1	T	A	4: 115,795,438	V12D	probably damaging	Het
Aurkb	C	A	11: 69,045,996	Y12*	probably null	Het
Bicdl1	A	G	5: 115,661,528		probably benign	Het
Bnc1	A	T	7: 81,978,408		probably benign	Het
Bpi	A	G	2: 158,261,426	I114V	possibly damaging	Het
Cacna1c	A	T	6: 118,675,896	I772N	probably damaging	Het
Cacna2d1	A	G	5: 16,365,862	N1045D	possibly damaging	Het
Ccrl2	A	G	9: 111,055,968	V154A	probably benign	Het
Celsr3	C	A	9: 108,846,025	Q2831K	possibly damaging	Het
Cul3	A	T	1: 80,290,118	M102K	probably damaging	Het
Cwf19l2	T	C	9: 3,441,047		probably benign	Het
Dlg5	G	A	14: 24,135,577	P1920L	probably damaging	Het
Dnah2	T	C	11: 69,421,308	H4393R	probably damaging	Het
Eif2b3	T	A	4: 117,081,578	V408D	possibly damaging	Het
Eml3	T	C	19: 8,933,311		probably null	Het
Enpp2	T	C	15: 54,906,959		probably benign	Het
Gm14178	T	A	11: 99,747,500	T18S		Het
H2-Bl	A	T	17: 36,083,932	V33E	probably damaging	Het
H2-M11	A	G	17: 36,549,214	M324V	probably benign	Het
Hdac10	T	C	15: 89,125,862	T298A	probably benign	Het
Hepacam	A	C	9: 37,383,928		probably benign	Het
Hist1h2bk	G	A	13: 22,036,040	D52N	probably damaging	Het
Hmx3	A	T	7: 131,543,084	H41L	probably benign	Het
Ifi27l2a	A	G	12: 103,442,380	V68A	probably damaging	Het
Itga11	A	G	9: 62,776,674	E1079G	probably benign	Het
Krt6a	T	C	15: 101,690,800		probably benign	Het
L1td1	A	G	4: 98,737,625	N686D	probably damaging	Het
Lrrtm2	G	A	18: 35,213,755	R165C	probably damaging	Het
Macf1	G	T	4: 123,385,478	A3910E	probably damaging	Het
Muc5ac	A	T	7: 141,807,515	Y1521F	possibly damaging	Het
Myo7a	A	T	7: 98,098,256	I129N	probably damaging	Het
Ncam1	A	T	9: 49,562,176		probably benign	Het
Nckap1	A	T	2: 80,554,249	C114S	probably benign	Het
Nf1	T	G	11: 79,453,866	W1260G	probably damaging	Het
Olfr1415	A	G	1: 92,491,405	S117P	possibly damaging	Het
Olfr411	T	C	11: 74,346,798	Y262C	probably damaging	Het
Olfr813	A	T	10: 129,856,646	I43F	probably damaging	Het
Oxtr	A	T	6: 112,489,637		probably null	Het
Pabpc4	C	T	4: 123,294,665	R356C	possibly damaging	Het
Pcbp2	T	A	15: 102,489,762	D182E	probably damaging	Het
Pgm1	A	T	5: 64,112,147	I526F	possibly damaging	Het
Rab43	A	T	6: 87,792,770	Y151*	probably null	Het
Rbm19	A	G	5: 120,126,204	E343G	probably benign	Het
Rel	A	T	11: 23,742,439	D531E	probably benign	Het
Rfx4	T	A	10: 84,868,427	V262E	probably damaging	Het
Rnf31	T	C	14: 55,593,002		probably benign	Het
Robo3	T	A	9: 37,429,482		probably benign	Het
Ryr3	A	G	2: 112,841,833	L1431P	probably damaging	Het
Sema3d	A	C	5: 12,463,216	D51A	possibly damaging	Het
Sema6a	A	G	18: 47,248,492	L996P	probably damaging	Het
Sh2d4a	T	A	8: 68,335,123	F294I	probably damaging	Het
Sox1ot	G	T	8: 12,430,455		noncoding transcript	Het
Spsb3	A	T	17: 24,891,384	N395I	probably damaging	Het
Sptan1	A	G	2: 30,016,028	N1662S	probably damaging	Het
Srd5a2	G	T	17: 74,024,521	N160K	probably damaging	Het
Tmem132d	G	A	5: 127,984,439		probably benign	Het
Tmem173	A	G	18: 35,735,101		probably null	Het
Unc80	A	T	1: 66,510,641	Q686L	possibly damaging	Het
Vmn2r93	A	G	17: 18,304,181	T146A	probably benign	Het
Wdr19	A	G	5: 65,256,439		probably benign	Het
Zfp646	C	T	7: 127,883,810	Q1500*	probably null	Het
Zfp683	T	C	4: 134,055,827	Y201H	probably benign	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGATATTGACCCCAGCGACTCTAC -3'
(R):5'- AAAGACTTGTACCTCCGCTGCTCC -3'

Sequencing Primer
(F):5'- CCAGCGACTCTACTGTGAAAATTTAG -3'
(R):5'- CTAGCTTAGAACTTTCTCCGGGTG -3'

Posted On

2013-11-08