Incidental Mutation 'R0924:Sorl1'
ID 83092
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
MMRRC Submission 039071-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R0924 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 41919470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably benign
Transcript: ENSMUST00000060989
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 114,432,028 (GRCm39) probably null Het
Ahcyl2 A C 6: 29,870,627 (GRCm39) probably null Het
Ajap1 T A 4: 153,470,929 (GRCm39) I293F probably damaging Het
Akap10 T C 11: 61,795,689 (GRCm39) probably benign Het
Aldh3b2 T C 19: 4,029,350 (GRCm39) V241A probably benign Het
Anxa6 A T 11: 54,885,214 (GRCm39) probably null Het
Atpaf1 T A 4: 115,652,635 (GRCm39) V12D probably damaging Het
Aurkb C A 11: 68,936,822 (GRCm39) Y12* probably null Het
Bicdl1 A G 5: 115,799,587 (GRCm39) probably benign Het
Bnc1 A T 7: 81,628,156 (GRCm39) probably benign Het
Bpi A G 2: 158,103,346 (GRCm39) I114V possibly damaging Het
Cacna1c A T 6: 118,652,857 (GRCm39) I772N probably damaging Het
Cacna2d1 A G 5: 16,570,860 (GRCm39) N1045D possibly damaging Het
Ccrl2 A G 9: 110,885,036 (GRCm39) V154A probably benign Het
Celsr3 C A 9: 108,723,224 (GRCm39) Q2831K possibly damaging Het
Cplane1 T C 15: 8,280,554 (GRCm39) probably benign Het
Cul3 A T 1: 80,267,835 (GRCm39) M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 (GRCm39) probably benign Het
Dlg5 G A 14: 24,185,645 (GRCm39) P1920L probably damaging Het
Dnah2 T C 11: 69,312,134 (GRCm39) H4393R probably damaging Het
Eif2b3 T A 4: 116,938,775 (GRCm39) V408D possibly damaging Het
Eml3 T C 19: 8,910,675 (GRCm39) probably null Het
Enpp2 T C 15: 54,770,355 (GRCm39) probably benign Het
Fcgbpl1 A T 7: 27,839,555 (GRCm39) Y456F probably damaging Het
Gm14178 T A 11: 99,638,326 (GRCm39) T18S Het
H2bc12 G A 13: 22,220,210 (GRCm39) D52N probably damaging Het
H2-M11 A G 17: 36,860,106 (GRCm39) M324V probably benign Het
H2-T13 A T 17: 36,394,824 (GRCm39) V33E probably damaging Het
Hdac10 T C 15: 89,010,065 (GRCm39) T298A probably benign Het
Hepacam A C 9: 37,295,224 (GRCm39) probably benign Het
Hmx3 A T 7: 131,144,813 (GRCm39) H41L probably benign Het
Ifi27l2a A G 12: 103,408,639 (GRCm39) V68A probably damaging Het
Itga11 A G 9: 62,683,956 (GRCm39) E1079G probably benign Het
Krt6a T C 15: 101,599,235 (GRCm39) probably benign Het
L1td1 A G 4: 98,625,862 (GRCm39) N686D probably damaging Het
Lrrtm2 G A 18: 35,346,808 (GRCm39) R165C probably damaging Het
Macf1 G T 4: 123,279,271 (GRCm39) A3910E probably damaging Het
Muc5ac A T 7: 141,361,252 (GRCm39) Y1521F possibly damaging Het
Myo7a A T 7: 97,747,463 (GRCm39) I129N probably damaging Het
Ncam1 A T 9: 49,473,476 (GRCm39) probably benign Het
Nckap1 A T 2: 80,384,593 (GRCm39) C114S probably benign Het
Nf1 T G 11: 79,344,692 (GRCm39) W1260G probably damaging Het
Or3a1d T C 11: 74,237,624 (GRCm39) Y262C probably damaging Het
Or6b2b A G 1: 92,419,127 (GRCm39) S117P possibly damaging Het
Or6c76b A T 10: 129,692,515 (GRCm39) I43F probably damaging Het
Oxtr A T 6: 112,466,598 (GRCm39) probably null Het
Pabpc4 C T 4: 123,188,458 (GRCm39) R356C possibly damaging Het
Pcbp2 T A 15: 102,398,197 (GRCm39) D182E probably damaging Het
Pgm2 A T 5: 64,269,490 (GRCm39) I526F possibly damaging Het
Rab43 A T 6: 87,769,752 (GRCm39) Y151* probably null Het
Rbm19 A G 5: 120,264,269 (GRCm39) E343G probably benign Het
Rel A T 11: 23,692,439 (GRCm39) D531E probably benign Het
Rfx4 T A 10: 84,704,291 (GRCm39) V262E probably damaging Het
Rnf31 T C 14: 55,830,459 (GRCm39) probably benign Het
Robo3 T A 9: 37,340,778 (GRCm39) probably benign Het
Ryr3 A G 2: 112,672,178 (GRCm39) L1431P probably damaging Het
Sema3d A C 5: 12,513,183 (GRCm39) D51A possibly damaging Het
Sema6a A G 18: 47,381,559 (GRCm39) L996P probably damaging Het
Sh2d4a T A 8: 68,787,775 (GRCm39) F294I probably damaging Het
Sox1ot G T 8: 12,480,455 (GRCm39) noncoding transcript Het
Spsb3 A T 17: 25,110,358 (GRCm39) N395I probably damaging Het
Sptan1 A G 2: 29,906,040 (GRCm39) N1662S probably damaging Het
Srd5a2 G T 17: 74,331,516 (GRCm39) N160K probably damaging Het
Sting1 A G 18: 35,868,154 (GRCm39) probably null Het
Tmem132d G A 5: 128,061,503 (GRCm39) probably benign Het
Unc80 A T 1: 66,549,800 (GRCm39) Q686L possibly damaging Het
Vmn2r93 A G 17: 18,524,443 (GRCm39) T146A probably benign Het
Wdr19 A G 5: 65,413,782 (GRCm39) probably benign Het
Zfp646 C T 7: 127,482,982 (GRCm39) Q1500* probably null Het
Zfp683 T C 4: 133,783,138 (GRCm39) Y201H probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATATTGACCCCAGCGACTCTAC -3'
(R):5'- AAAGACTTGTACCTCCGCTGCTCC -3'

Sequencing Primer
(F):5'- CCAGCGACTCTACTGTGAAAATTTAG -3'
(R):5'- CTAGCTTAGAACTTTCTCCGGGTG -3'
Posted On 2013-11-08