Incidental Mutation 'R0924:Itga11'
ID83094
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62776674 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1079 (E1079G)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: E1079G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: E1079G

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACTTCAAATCTGGCCTCCTTGC -3'
(R):5'- GCGTTGACTGTGATCTTCAGAGACC -3'

Sequencing Primer
(F):5'- TGCTTCCCAGATGGTCCAG -3'
(R):5'- GACCTGTACTTGAGCTGTAAGACC -3'
Posted On2013-11-08