Incidental Mutation 'R0924:Hdac10'
ID83113
Institutional Source Beutler Lab
Gene Symbol Hdac10
Ensembl Gene ENSMUSG00000062906
Gene Namehistone deacetylase 10
Synonyms
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89123307-89128700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89125862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 298 (T298A)
Ref Sequence ENSEMBL: ENSMUSP00000104971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000088827] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082197
AA Change: T348A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906
AA Change: T348A

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109347
AA Change: T298A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906
AA Change: T298A

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Hdac10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Hdac10 APN 15 89128442 missense probably damaging 1.00
IGL01063:Hdac10 APN 15 89123868 missense possibly damaging 0.68
IGL01577:Hdac10 APN 15 89126213 missense possibly damaging 0.90
IGL01690:Hdac10 APN 15 89125991 missense probably benign 0.00
IGL01724:Hdac10 APN 15 89124709 unclassified probably benign
IGL01866:Hdac10 APN 15 89124533 missense probably damaging 1.00
IGL01989:Hdac10 APN 15 89125343 missense probably damaging 1.00
IGL01995:Hdac10 APN 15 89127598 missense probably damaging 1.00
IGL02256:Hdac10 APN 15 89125894 unclassified probably benign
IGL02668:Hdac10 APN 15 89125644 missense probably benign 0.10
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0454:Hdac10 UTSW 15 89125758 splice site probably null
R0723:Hdac10 UTSW 15 89126418 missense probably damaging 1.00
R1553:Hdac10 UTSW 15 89125515 missense possibly damaging 0.51
R1608:Hdac10 UTSW 15 89125318 missense probably benign 0.04
R1619:Hdac10 UTSW 15 89126675 missense probably damaging 1.00
R1715:Hdac10 UTSW 15 89126709 splice site probably null
R2284:Hdac10 UTSW 15 89127404 missense probably benign 0.00
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R3688:Hdac10 UTSW 15 89123564 critical splice donor site probably null
R4283:Hdac10 UTSW 15 89125623 missense possibly damaging 0.94
R4604:Hdac10 UTSW 15 89125397 critical splice acceptor site probably null
R4654:Hdac10 UTSW 15 89126833 unclassified probably benign
R4898:Hdac10 UTSW 15 89128447 start codon destroyed probably null 1.00
R4998:Hdac10 UTSW 15 89123940 missense possibly damaging 0.94
R5393:Hdac10 UTSW 15 89126684 missense probably damaging 1.00
R5769:Hdac10 UTSW 15 89123616 missense probably benign 0.00
R5785:Hdac10 UTSW 15 89126945 missense probably benign
R6992:Hdac10 UTSW 15 89125331 missense probably benign 0.01
R7149:Hdac10 UTSW 15 89127449 missense probably damaging 1.00
R7237:Hdac10 UTSW 15 89125377 missense probably benign
R7276:Hdac10 UTSW 15 89128285 missense probably benign 0.01
R7395:Hdac10 UTSW 15 89128284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACTGACCCTTCTTGATGGAGCACTC -3'
(R):5'- ATGGTGCAGACACTGCTTGGTGAC -3'

Sequencing Primer
(F):5'- AGCAGCACCTGGTACAGTC -3'
(R):5'- ACTGCTTGGTGACCCCAC -3'
Posted On2013-11-08