Incidental Mutation 'R0924:Krt6a'
ID 83114
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Name keratin 6A
Synonyms Krt2-6a, MK6a, mK6[a], Krt2-6c
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R0924 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101689910-101694307 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 101690800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
AlphaFold P50446
Predicted Effect probably benign
Transcript: ENSMUST00000023788
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354

Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230205
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101692794 missense probably damaging 1.00
IGL00596:Krt6a APN 15 101694230 missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101693917 missense probably damaging 0.98
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0811:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0812:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0828:Krt6a UTSW 15 101693836 missense probably damaging 0.99
R1525:Krt6a UTSW 15 101694202 missense probably benign
R1591:Krt6a UTSW 15 101692357 splice site probably null
R1725:Krt6a UTSW 15 101692557 missense probably damaging 1.00
R1962:Krt6a UTSW 15 101691465 missense probably damaging 1.00
R2201:Krt6a UTSW 15 101693171 missense probably benign 0.41
R3024:Krt6a UTSW 15 101691289 missense probably benign 0.02
R3158:Krt6a UTSW 15 101691366 missense probably damaging 1.00
R5369:Krt6a UTSW 15 101692558 missense probably benign 0.06
R5637:Krt6a UTSW 15 101692279 missense probably benign 0.25
R6164:Krt6a UTSW 15 101692573 missense probably damaging 0.99
R6320:Krt6a UTSW 15 101692309 missense probably damaging 0.99
R6562:Krt6a UTSW 15 101691659 missense probably benign 0.36
R7267:Krt6a UTSW 15 101693854 missense probably benign 0.03
R7560:Krt6a UTSW 15 101690559 missense unknown
R7621:Krt6a UTSW 15 101691752 missense possibly damaging 0.92
R7671:Krt6a UTSW 15 101690543 missense unknown
R8017:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8019:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8318:Krt6a UTSW 15 101694247 start codon destroyed probably null 0.02
R8508:Krt6a UTSW 15 101692735 missense probably damaging 1.00
R9183:Krt6a UTSW 15 101693011 missense probably benign 0.03
X0067:Krt6a UTSW 15 101693777 missense possibly damaging 0.83
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtttaattcccagcaaccacc -3'
Posted On 2013-11-08