Incidental Mutation 'R0924:Lrrtm2'
ID83121
Institutional Source Beutler Lab
Gene Symbol Lrrtm2
Ensembl Gene ENSMUSG00000071862
Gene Nameleucine rich repeat transmembrane neuronal 2
SynonymsC630011A14Rik
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35209011-35215024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35213755 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 165 (R165C)
Ref Sequence ENSEMBL: ENSMUSP00000089225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345] [ENSMUST00000091636]
Predicted Effect probably benign
Transcript: ENSMUST00000042345
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091636
AA Change: R165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089225
Gene: ENSMUSG00000071862
AA Change: R165C

DomainStartEndE-ValueType
LRRNT 33 61 2.45e0 SMART
LRR_TYP 84 107 5.14e-3 SMART
LRR_TYP 108 131 3.58e-2 SMART
LRR_TYP 132 155 1.6e-4 SMART
LRR_TYP 156 179 4.24e-4 SMART
LRR 180 203 1.14e0 SMART
LRR 204 224 6.05e0 SMART
LRR 228 251 5.12e1 SMART
LRR 252 275 1.97e2 SMART
LRR 276 299 2.45e0 SMART
Blast:LRRCT 311 360 2e-11 BLAST
transmembrane domain 422 444 N/A INTRINSIC
Meta Mutation Damage Score 0.4268 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype NO_PHENOTYPE,Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis.
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Lrrtm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrtm2 APN 18 35213268 missense probably benign 0.13
IGL00835:Lrrtm2 APN 18 35214239 missense probably benign 0.03
IGL01097:Lrrtm2 APN 18 35212941 missense probably damaging 1.00
IGL01589:Lrrtm2 APN 18 35212798 missense probably damaging 1.00
IGL02106:Lrrtm2 APN 18 35212815 nonsense probably null
R0149:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R0361:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R1189:Lrrtm2 UTSW 18 35213492 nonsense probably null
R1417:Lrrtm2 UTSW 18 35213958 missense probably damaging 1.00
R1585:Lrrtm2 UTSW 18 35213375 missense possibly damaging 0.86
R3433:Lrrtm2 UTSW 18 35213897 missense probably damaging 1.00
R4019:Lrrtm2 UTSW 18 35212870 missense possibly damaging 0.76
R4540:Lrrtm2 UTSW 18 35213146 missense probably benign 0.29
R4664:Lrrtm2 UTSW 18 35214257 splice site probably null
R4879:Lrrtm2 UTSW 18 35213319 missense probably damaging 0.98
R5797:Lrrtm2 UTSW 18 35213706 missense probably damaging 1.00
R7378:Lrrtm2 UTSW 18 35213592 missense probably damaging 1.00
R7387:Lrrtm2 UTSW 18 35212972 missense probably damaging 1.00
R7391:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R7408:Lrrtm2 UTSW 18 35213635 missense possibly damaging 0.88
R7584:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R7629:Lrrtm2 UTSW 18 35214257 splice site probably null
Z1176:Lrrtm2 UTSW 18 35214659 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTGTGCAGACTGCTTAGCC -3'
(R):5'- TGCCAGCTTCAGTCAACTCACC -3'

Sequencing Primer
(F):5'- AGACTGCTTAGCCGGAGG -3'
(R):5'- AGACGCTTTCCAAGGACTG -3'
Posted On2013-11-08