Incidental Mutation 'R0925:Gabpb1'
ID83128
Institutional Source Beutler Lab
Gene Symbol Gabpb1
Ensembl Gene ENSMUSG00000027361
Gene NameGA repeat binding protein, beta 1
SynonymsGABPB1-1, E4TF1-47, GABPB1-2, E4Tf1B, BABPB2, NRF2B2, E4TF1, E4TF1-53, NRF2B1
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126627442-126676337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126652265 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 147 (N147Y)
Ref Sequence ENSEMBL: ENSMUSP00000037673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039978] [ENSMUST00000089745] [ENSMUST00000103226] [ENSMUST00000103227] [ENSMUST00000110424] [ENSMUST00000110425] [ENSMUST00000124972] [ENSMUST00000137335]
Predicted Effect probably damaging
Transcript: ENSMUST00000039978
AA Change: N147Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037673
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089745
AA Change: N147Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087177
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 4e-9 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103226
AA Change: N147Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099516
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103227
AA Change: N147Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099517
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110424
AA Change: N147Y

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106054
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110425
AA Change: N147Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106055
Gene: ENSMUSG00000027361
AA Change: N147Y

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
coiled coil region 329 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124972
SMART Domains Protein: ENSMUSP00000117355
Gene: ENSMUSG00000027361

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-10 BLAST
ANK 37 66 3.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130263
Predicted Effect probably benign
Transcript: ENSMUST00000137335
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Gabpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Gabpb1 APN 2 126653600 missense possibly damaging 0.83
IGL02085:Gabpb1 APN 2 126639271 nonsense probably null
IGL02190:Gabpb1 APN 2 126653549 unclassified probably benign
R0034:Gabpb1 UTSW 2 126658534 missense possibly damaging 0.94
R0114:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R0800:Gabpb1 UTSW 2 126630328 missense probably damaging 0.99
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1497:Gabpb1 UTSW 2 126639249 missense possibly damaging 0.96
R1569:Gabpb1 UTSW 2 126652251 missense probably benign 0.09
R2860:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R2861:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R5284:Gabpb1 UTSW 2 126652357 missense possibly damaging 0.93
R5984:Gabpb1 UTSW 2 126646653 missense probably damaging 0.99
R7200:Gabpb1 UTSW 2 126639302 missense possibly damaging 0.73
R7781:Gabpb1 UTSW 2 126639200 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAGGTAAGCGCCTTCTCTAACCTTCC -3'
(R):5'- TATGTGACAGTGCCGTACACAGCTCTC -3'

Sequencing Primer
(F):5'- GGAGAGAACATGGCCATTCA -3'
(R):5'- GTTTTGGAGACAAACTCAGTGC -3'
Posted On2013-11-08