Incidental Mutation 'R0925:Hemgn'
ID83134
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46397049 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 62 (K62N)
Ref Sequence ENSEMBL: ENSMUSP00000103393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect probably damaging
Transcript: ENSMUST00000071096
AA Change: K62N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: K62N

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107764
AA Change: K62N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: K62N

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
PIT4504001:Hemgn UTSW 4 46395863 missense probably benign
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46396421 missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R5456:Hemgn UTSW 4 46396571 missense probably damaging 0.99
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6575:Hemgn UTSW 4 46395990 missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46396145 missense probably damaging 0.96
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
R8181:Hemgn UTSW 4 46396504 missense possibly damaging 0.52
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGTTGCAGAGTTCCCAGGGTG -3'
(R):5'- CCAACCAGTGGATTTCCATAGGCTTTT -3'

Sequencing Primer
(F):5'- GTGCTCGGTTTCTTCCTCAG -3'
(R):5'- ctccctctctttctctttctctc -3'
Posted On2013-11-08