Incidental Mutation 'R0925:Pigv'
ID83135
Institutional Source Beutler Lab
Gene Symbol Pigv
Ensembl Gene ENSMUSG00000043257
Gene Namephosphatidylinositol glycan anchor biosynthesis, class V
Synonyms
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133660387-133672647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133662649 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 74 (K74R)
Ref Sequence ENSEMBL: ENSMUSP00000065601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062118] [ENSMUST00000067902]
Predicted Effect probably benign
Transcript: ENSMUST00000062118
AA Change: K448R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000050647
Gene: ENSMUSG00000043257
AA Change: K448R

DomainStartEndE-ValueType
Pfam:Mannosyl_trans2 8 493 6.4e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067902
AA Change: K74R

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065601
Gene: ENSMUSG00000043257
AA Change: K74R

DomainStartEndE-ValueType
Pfam:Mannosyl_trans2 10 119 2.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannosyltransferase enzyme involved in the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is a complex glycolipid that functions as a membrane anchor for many proteins and plays a role in multiple cellular processes including protein sorting and signal transduction. The encoded protein is localized to the endoplasmic reticulum and transfers the second mannose to the GPI backbone. Mutations in this gene are associated with hyperphosphatasia mental retardation syndrome. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy, are runted, have thymus hypoplasia and show craniofacial and kidney defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Pigv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Pigv APN 4 133665117 missense probably benign 0.01
IGL03157:Pigv APN 4 133665530 missense probably benign 0.01
R0256:Pigv UTSW 4 133665751 missense probably damaging 1.00
R1733:Pigv UTSW 4 133664926 missense probably damaging 1.00
R2014:Pigv UTSW 4 133662723 missense possibly damaging 0.55
R3794:Pigv UTSW 4 133665191 missense possibly damaging 0.94
R3795:Pigv UTSW 4 133665191 missense possibly damaging 0.94
R4349:Pigv UTSW 4 133664816 missense probably benign
R5729:Pigv UTSW 4 133664823 nonsense probably null
R6014:Pigv UTSW 4 133665429 missense probably benign 0.00
R6343:Pigv UTSW 4 133665236 missense probably damaging 1.00
R6885:Pigv UTSW 4 133665481 missense probably damaging 0.99
R7638:Pigv UTSW 4 133665451 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCACTGAGCACTGAAGTTACTCCC -3'
(R):5'- TGATTGACCCAGCCACATCACTG -3'

Sequencing Primer
(F):5'- GAGATCCTACTGCACAGTGCTC -3'
(R):5'- TGATGCTCCAACCAACATGG -3'
Posted On2013-11-08