Incidental Mutation 'R0925:Dnajb6'
ID83138
Institutional Source Beutler Lab
Gene Symbol Dnajb6
Ensembl Gene ENSMUSG00000029131
Gene NameDnaJ heat shock protein family (Hsp40) member B6
SynonymsmDj4, Mrj
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29735688-29818134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29752400 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 60 (K60I)
Ref Sequence ENSEMBL: ENSMUSP00000110488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008733] [ENSMUST00000012734] [ENSMUST00000114839] [ENSMUST00000196528] [ENSMUST00000196785] [ENSMUST00000198694]
Predicted Effect probably damaging
Transcript: ENSMUST00000008733
AA Change: K60I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008733
Gene: ENSMUSG00000029131
AA Change: K60I

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 272 293 N/A INTRINSIC
low complexity region 339 363 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000012734
AA Change: K60I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000012734
Gene: ENSMUSG00000029131
AA Change: K60I

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 223 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114839
AA Change: K60I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110488
Gene: ENSMUSG00000029131
AA Change: K60I

DomainStartEndE-ValueType
DnaJ 2 61 4.64e-32 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151976
Predicted Effect possibly damaging
Transcript: ENSMUST00000196528
AA Change: K60I

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142878
Gene: ENSMUSG00000029131
AA Change: K60I

DomainStartEndE-ValueType
DnaJ 2 61 3e-34 SMART
low complexity region 109 124 N/A INTRINSIC
low complexity region 125 158 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196785
Predicted Effect probably benign
Transcript: ENSMUST00000198694
SMART Domains Protein: ENSMUSP00000142783
Gene: ENSMUSG00000029131

DomainStartEndE-ValueType
DnaJ 2 61 1.4e-23 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ protein family. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. This family member may also play a role in polyglutamine aggregation in specific neurons. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants died at mid-gestation due to a failure of chorioallantoic fusion at embryonic day 8.5, and thus preventing the formation of a mature placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Dnajb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Dnajb6 APN 5 29752418 missense probably damaging 1.00
IGL02706:Dnajb6 APN 5 29752423 missense probably damaging 1.00
R0211:Dnajb6 UTSW 5 29785079 intron probably benign
R0829:Dnajb6 UTSW 5 29785022 intron probably benign
R1776:Dnajb6 UTSW 5 29785093 intron probably benign
R2357:Dnajb6 UTSW 5 29753640 missense probably damaging 0.98
R3979:Dnajb6 UTSW 5 29751008 missense possibly damaging 0.88
R4151:Dnajb6 UTSW 5 29756236 missense probably benign
R6243:Dnajb6 UTSW 5 29781133 missense probably benign 0.08
R6671:Dnajb6 UTSW 5 29748420 missense probably damaging 0.98
R7206:Dnajb6 UTSW 5 29781337 missense possibly damaging 0.94
R7440:Dnajb6 UTSW 5 29757859 missense possibly damaging 0.85
R7536:Dnajb6 UTSW 5 29757806 missense possibly damaging 0.72
R8334:Dnajb6 UTSW 5 29781240 missense unknown
Z1176:Dnajb6 UTSW 5 29752445 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTCACGCATACCAGCGTAGCAC -3'
(R):5'- TCAAGGCAAATCCCTGTTGACTATCAG -3'

Sequencing Primer
(F):5'- CAAGCAGATCCTGAGTCTGAGC -3'
(R):5'- cgggaggcagagagagg -3'
Posted On2013-11-08