Incidental Mutation 'R0925:Klk1'
ID83143
Institutional Source Beutler Lab
Gene Symbol Klk1
Ensembl Gene ENSMUSG00000063903
Gene Namekallikrein 1
SynonymsKlk6, mGk-6
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44225360-44229618 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 44228816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037220] [ENSMUST00000075162] [ENSMUST00000206144] [ENSMUST00000206144] [ENSMUST00000206366] [ENSMUST00000206686]
Predicted Effect probably benign
Transcript: ENSMUST00000037220
SMART Domains Protein: ENSMUSP00000048665
Gene: ENSMUSG00000038782

DomainStartEndE-ValueType
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075162
SMART Domains Protein: ENSMUSP00000074659
Gene: ENSMUSG00000063903

DomainStartEndE-ValueType
Tryp_SPc 24 253 7.26e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205329
Predicted Effect probably null
Transcript: ENSMUST00000206144
Predicted Effect probably null
Transcript: ENSMUST00000206144
Predicted Effect probably benign
Transcript: ENSMUST00000206366
Predicted Effect probably benign
Transcript: ENSMUST00000206686
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein are unable to generate significant levels of kinins in most tissues, develop cardiovascular abnormalities and exhibit hypercalciuria of renal origin. This gene is located in a cluster of several related kallikrein genes on chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Klk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Klk1 APN 7 44228596 missense probably damaging 0.98
IGL01788:Klk1 APN 7 44228983 missense probably benign 0.00
R0011:Klk1 UTSW 7 44229535 missense probably benign 0.03
R0184:Klk1 UTSW 7 44228749 missense possibly damaging 0.50
R0853:Klk1 UTSW 7 44221498 unclassified probably benign
R2044:Klk1 UTSW 7 44229034 missense possibly damaging 0.95
R2518:Klk1 UTSW 7 44220737 unclassified probably null
R2982:Klk1 UTSW 7 44229439 missense probably damaging 1.00
R3962:Klk1 UTSW 7 44229549 missense possibly damaging 0.87
R4041:Klk1 UTSW 7 44229562 missense probably damaging 1.00
R4067:Klk1 UTSW 7 44227544 nonsense probably null
R4385:Klk1 UTSW 7 44228569 missense probably benign 0.12
R4901:Klk1 UTSW 7 44228715 missense probably damaging 0.99
R5256:Klk1 UTSW 7 44221561 unclassified probably benign
R5580:Klk1 UTSW 7 44228814 missense probably benign 0.00
R5595:Klk1 UTSW 7 44228737 unclassified probably null
R6818:Klk1 UTSW 7 44229459 missense probably damaging 1.00
R7100:Klk1 UTSW 7 44229424 missense probably damaging 1.00
R8351:Klk1 UTSW 7 44228986 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATGAGCCTCCTGAATGAGCACACC -3'
(R):5'- ACCGCACAAGTGTCTTTGCCTC -3'

Sequencing Primer
(F):5'- CCCCACAACCTGAGGATG -3'
(R):5'- TGCACACAACATGTCATCTGTC -3'
Posted On2013-11-08