Incidental Mutation 'R0925:Olfr592'
ID83145
Institutional Source Beutler Lab
Gene Symbol Olfr592
Ensembl Gene ENSMUSG00000073956
Gene Nameolfactory receptor 592
SynonymsMOR0-3P, MOR32-13, GA_x6K02T2PBJ9-5902266-5903204, Olfr1525-ps1, MOR0-3P
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103184803-103192965 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103186823 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 74 (L74*)
Ref Sequence ENSEMBL: ENSMUSP00000153755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098207] [ENSMUST00000106893] [ENSMUST00000218618]
Predicted Effect probably null
Transcript: ENSMUST00000098207
AA Change: L74*
SMART Domains Protein: ENSMUSP00000095808
Gene: ENSMUSG00000073956
AA Change: L74*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 309 1.4e-6 PFAM
Pfam:7tm_1 44 294 2.6e-26 PFAM
Pfam:7tm_4 141 287 2.3e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106893
AA Change: L74*
SMART Domains Protein: ENSMUSP00000102506
Gene: ENSMUSG00000073956
AA Change: L74*

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 6.9e-112 PFAM
Pfam:7TM_GPCR_Srsx 38 309 1.4e-6 PFAM
Pfam:7tm_1 44 294 1.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218618
AA Change: L74*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Olfr592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr592 APN 7 103187410 missense probably damaging 0.99
IGL01650:Olfr592 APN 7 103187079 missense probably benign 0.01
IGL02682:Olfr592 APN 7 103187014 missense probably damaging 0.99
R1543:Olfr592 UTSW 7 103187214 missense probably benign 0.26
R1761:Olfr592 UTSW 7 103187118 missense probably damaging 1.00
R2017:Olfr592 UTSW 7 103186930 missense probably benign 0.00
R2152:Olfr592 UTSW 7 103186640 missense probably benign
R4678:Olfr592 UTSW 7 103186891 missense probably damaging 0.97
R4679:Olfr592 UTSW 7 103187102 missense probably benign 0.05
R5177:Olfr592 UTSW 7 103187503 missense probably benign 0.11
R5986:Olfr592 UTSW 7 103187528 missense possibly damaging 0.87
R6808:Olfr592 UTSW 7 103187304 missense probably benign 0.18
R7400:Olfr592 UTSW 7 103187380 missense probably damaging 1.00
RF005:Olfr592 UTSW 7 103186691 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTCTGGAGGAAATCCATGCCTG -3'
(R):5'- GGGCTTTTAACCGTGCATCCTGAG -3'

Sequencing Primer
(F):5'- AATCCATGCCTGGATTTCTCTG -3'
(R):5'- GCCCATGTGTTCACAATAGG -3'
Posted On2013-11-08