Incidental Mutation 'R0925:Hormad2'
ID83157
Institutional Source Beutler Lab
Gene Symbol Hormad2
Ensembl Gene ENSMUSG00000020419
Gene NameHORMA domain containing 2
Synonyms
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4345814-4441105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4427297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 47 (T47M)
Ref Sequence ENSEMBL: ENSMUSP00000121715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020689] [ENSMUST00000109948] [ENSMUST00000109949] [ENSMUST00000130174]
Predicted Effect probably damaging
Transcript: ENSMUST00000020689
AA Change: T47M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020689
Gene: ENSMUSG00000020419
AA Change: T47M

DomainStartEndE-ValueType
Pfam:HORMA 27 65 1.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109948
AA Change: T47M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105574
Gene: ENSMUSG00000020419
AA Change: T47M

DomainStartEndE-ValueType
Pfam:HORMA 28 226 8.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109949
AA Change: T47M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105575
Gene: ENSMUSG00000020419
AA Change: T47M

DomainStartEndE-ValueType
Pfam:HORMA 27 226 6.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124249
Predicted Effect probably damaging
Transcript: ENSMUST00000130174
AA Change: T47M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121715
Gene: ENSMUSG00000020419
AA Change: T47M

DomainStartEndE-ValueType
Pfam:HORMA 27 103 6.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149443
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to arrest of spermatogenesis, male infertility, and abnormalities in male and female meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Hormad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02245:Hormad2 APN 11 4408580 splice site probably benign
R0116:Hormad2 UTSW 11 4412206 splice site probably benign
R0504:Hormad2 UTSW 11 4408833 missense possibly damaging 0.78
R1344:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1418:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1512:Hormad2 UTSW 11 4424788 missense probably damaging 1.00
R1562:Hormad2 UTSW 11 4408848 splice site probably null
R2158:Hormad2 UTSW 11 4424808 nonsense probably null
R3405:Hormad2 UTSW 11 4424302 missense probably damaging 1.00
R3727:Hormad2 UTSW 11 4408598 missense probably benign
R3903:Hormad2 UTSW 11 4427237 splice site probably benign
R6277:Hormad2 UTSW 11 4421583 splice site probably null
R7468:Hormad2 UTSW 11 4412245 nonsense probably null
R7633:Hormad2 UTSW 11 4346662 missense probably benign 0.00
R7912:Hormad2 UTSW 11 4408841 missense probably damaging 1.00
R8129:Hormad2 UTSW 11 4346648 missense probably benign 0.02
R8306:Hormad2 UTSW 11 4408714 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ATTGATCTTGAAGGACACACCCATGAG -3'
(R):5'- TTGTACATGGTAACTTTGGAGAGAGCG -3'

Sequencing Primer
(F):5'- CCATGAGATAGGATTAACACAGTCTG -3'
(R):5'- GGGAAACTCCCAATTTTGCTTCAG -3'
Posted On2013-11-08