Incidental Mutation 'R0925:Nupl1'
ID83162
Institutional Source Beutler Lab
Gene Symbol Nupl1
Ensembl Gene ENSMUSG00000063895
Gene Namenucleoporin like 1
Synonyms1700017F11Rik
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60184612-60251431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60220141 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000038716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041905] [ENSMUST00000225111] [ENSMUST00000225311] [ENSMUST00000225805]
Predicted Effect probably damaging
Transcript: ENSMUST00000041905
AA Change: T538A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038716
Gene: ENSMUSG00000114797
AA Change: T538A

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG2 3 587 1.5e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223713
Predicted Effect probably benign
Transcript: ENSMUST00000225111
Predicted Effect probably benign
Transcript: ENSMUST00000225311
Predicted Effect probably benign
Transcript: ENSMUST00000225805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225931
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family that shares 87% sequence identity with rat nucleoporin p58. The protein is localized to the nuclear rim and is a component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Nupl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nupl1 APN 14 60242577 missense probably benign 0.01
IGL00693:Nupl1 APN 14 60238520 missense probably benign 0.10
IGL00725:Nupl1 APN 14 60243440 missense possibly damaging 0.84
IGL00969:Nupl1 APN 14 60228916 splice site probably benign
IGL03243:Nupl1 APN 14 60221616 missense probably benign 0.06
IGL03351:Nupl1 APN 14 60228775 missense probably benign 0.19
R0056:Nupl1 UTSW 14 60239475 splice site probably null
R0113:Nupl1 UTSW 14 60251291 start gained probably benign
R0201:Nupl1 UTSW 14 60244616 missense probably benign 0.32
R0830:Nupl1 UTSW 14 60243482 missense probably damaging 1.00
R1004:Nupl1 UTSW 14 60247481 splice site probably benign
R1178:Nupl1 UTSW 14 60244670 splice site probably benign
R1181:Nupl1 UTSW 14 60244670 splice site probably benign
R1268:Nupl1 UTSW 14 60244670 splice site probably benign
R1388:Nupl1 UTSW 14 60244670 splice site probably benign
R1411:Nupl1 UTSW 14 60244670 splice site probably benign
R1442:Nupl1 UTSW 14 60232543 splice site probably benign
R1626:Nupl1 UTSW 14 60242627 nonsense probably null
R1697:Nupl1 UTSW 14 60244670 splice site probably benign
R1756:Nupl1 UTSW 14 60244670 splice site probably benign
R1853:Nupl1 UTSW 14 60244547 missense possibly damaging 0.81
R1915:Nupl1 UTSW 14 60238531 missense probably benign 0.00
R2160:Nupl1 UTSW 14 60239508 missense probably benign 0.15
R2211:Nupl1 UTSW 14 60232640 missense probably damaging 0.99
R2213:Nupl1 UTSW 14 60239496 missense probably benign 0.01
R2518:Nupl1 UTSW 14 60232660 missense probably damaging 1.00
R2519:Nupl1 UTSW 14 60223359 missense probably benign 0.23
R3914:Nupl1 UTSW 14 60232147 missense possibly damaging 0.76
R4302:Nupl1 UTSW 14 60247426 missense probably benign 0.44
R4626:Nupl1 UTSW 14 60238555 missense probably benign 0.24
R4705:Nupl1 UTSW 14 60251215 missense unknown
R4772:Nupl1 UTSW 14 60220022 missense probably benign 0.00
R6151:Nupl1 UTSW 14 60244616 missense possibly damaging 0.71
R6187:Nupl1 UTSW 14 60240807 splice site probably null
R6546:Nupl1 UTSW 14 60223223 intron probably null
Predicted Primers PCR Primer
(F):5'- ATCATAGAATGAGCGGCAGCCAGC -3'
(R):5'- GCCCAGATGCCTTGAGTGTGTTTTC -3'

Sequencing Primer
(F):5'- GGCAGCCAGCTAAGCAC -3'
(R):5'- CAGACAAAGTTTCTGGTAGCTTG -3'
Posted On2013-11-08