Incidental Mutation 'R0925:Wdfy2'
ID83163
Institutional Source Beutler Lab
Gene Symbol Wdfy2
Ensembl Gene ENSMUSG00000014547
Gene NameWD repeat and FYVE domain containing 2
SynonymsB130024L21Rik
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location62837678-62961509 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 62930226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014691] [ENSMUST00000014691]
Predicted Effect probably null
Transcript: ENSMUST00000014691
SMART Domains Protein: ENSMUSP00000014691
Gene: ENSMUSG00000014547

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
Blast:WD40 56 96 1e-21 BLAST
WD40 103 142 1.43e1 SMART
Blast:WD40 145 183 2e-16 BLAST
WD40 188 227 6.68e-10 SMART
WD40 231 270 5.31e-4 SMART
FYVE 276 353 1.04e-22 SMART
WD40 355 394 7e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000014691
SMART Domains Protein: ENSMUSP00000014691
Gene: ENSMUSG00000014547

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
Blast:WD40 56 96 1e-21 BLAST
WD40 103 142 1.43e1 SMART
Blast:WD40 145 183 2e-16 BLAST
WD40 188 227 6.68e-10 SMART
WD40 231 270 5.31e-4 SMART
FYVE 276 353 1.04e-22 SMART
WD40 355 394 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224948
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains two WD domains and an FYVE zinc finger region. The function of this gene is unknown. An alternatively spliced transcript variant of this gene may exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Other mutations in Wdfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Wdfy2 APN 14 62944077 missense probably damaging 0.98
IGL02374:Wdfy2 APN 14 62934384 missense probably benign 0.06
IGL03039:Wdfy2 APN 14 62948720 missense probably benign 0.36
Special_k UTSW 14 62948666 missense probably damaging 1.00
R0391:Wdfy2 UTSW 14 62925133 missense possibly damaging 0.83
R1711:Wdfy2 UTSW 14 62944097 missense probably benign 0.00
R4299:Wdfy2 UTSW 14 62925140 nonsense probably null
R5372:Wdfy2 UTSW 14 62954885 missense probably damaging 1.00
R6418:Wdfy2 UTSW 14 62925133 missense probably benign 0.32
R6466:Wdfy2 UTSW 14 62948666 missense probably damaging 1.00
R7055:Wdfy2 UTSW 14 62900299 missense probably benign 0.00
R7977:Wdfy2 UTSW 14 62951931 missense possibly damaging 0.57
R7987:Wdfy2 UTSW 14 62951931 missense possibly damaging 0.57
X0019:Wdfy2 UTSW 14 62948743 nonsense probably null
Z1176:Wdfy2 UTSW 14 62934333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACACTGGGCGCAGTTTCC -3'
(R):5'- GAACTATGTCACAGCAGTCAGCAGG -3'

Sequencing Primer
(F):5'- GGGTATAACACCAGGCTGC -3'
(R):5'- CGAGCCTTAAGAAGTTCTCTGAG -3'
Posted On2013-11-08