Incidental Mutation 'R0925:Gmnc'
ID83170
Institutional Source Beutler Lab
Gene Symbol Gmnc
Ensembl Gene ENSMUSG00000068428
Gene Namegeminin coiled-coil domain containing
SynonymsLOC385639, Gm606, LOC239789
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location26913553-26991652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26960423 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 278 (L278P)
Ref Sequence ENSEMBL: ENSMUSP00000156070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089832] [ENSMUST00000231299] [ENSMUST00000231417] [ENSMUST00000231969]
Predicted Effect probably benign
Transcript: ENSMUST00000089832
AA Change: L284P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087269
Gene: ENSMUSG00000068428
AA Change: L284P

DomainStartEndE-ValueType
coiled coil region 89 124 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231299
AA Change: L236P

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000231417
Predicted Effect probably benign
Transcript: ENSMUST00000231969
AA Change: L278P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die within the first postnatal week exhibiting severe postnatal growth retardation and absence of respiratory motile cilia in tracheal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Gmnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Gmnc APN 16 26963939 missense probably damaging 0.99
IGL01612:Gmnc APN 16 26960319 nonsense probably null
IGL02600:Gmnc APN 16 26962891 splice site probably benign
R0465:Gmnc UTSW 16 26962952 missense probably damaging 0.98
R1388:Gmnc UTSW 16 26963912 missense probably damaging 1.00
R1405:Gmnc UTSW 16 26960446 missense possibly damaging 0.86
R1405:Gmnc UTSW 16 26960446 missense possibly damaging 0.86
R1566:Gmnc UTSW 16 26963939 missense probably damaging 0.99
R1574:Gmnc UTSW 16 26963979 splice site probably benign
R1759:Gmnc UTSW 16 26965747 missense possibly damaging 0.82
R1880:Gmnc UTSW 16 26965611 missense probably damaging 1.00
R2151:Gmnc UTSW 16 26960706 missense possibly damaging 0.91
R3017:Gmnc UTSW 16 26960415 missense probably benign 0.00
R3437:Gmnc UTSW 16 26960467 missense probably benign 0.02
R5078:Gmnc UTSW 16 26965582 missense probably benign 0.13
R5225:Gmnc UTSW 16 26963945 missense probably benign 0.04
R5589:Gmnc UTSW 16 26962964 missense probably damaging 1.00
R6615:Gmnc UTSW 16 26960528 missense probably benign 0.14
R7078:Gmnc UTSW 16 26960522 missense probably benign
R7183:Gmnc UTSW 16 26960529 missense probably benign 0.08
R7284:Gmnc UTSW 16 26960792 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CCCTGCAAGTTGATGTGTGTAGCC -3'
(R):5'- TCCCAGAGCAGTTCCCAGTATTTCC -3'

Sequencing Primer
(F):5'- TCTTTACAGACAGAAGTCCTGGC -3'
(R):5'- ATTTCCTCTCTGTTTGTACATGATG -3'
Posted On2013-11-08