Incidental Mutation 'R0925:Myo1f'
ID83171
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33578133 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 123 (I123F)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372] [ENSMUST00000174695]
Predicted Effect probably damaging
Transcript: ENSMUST00000087605
AA Change: I123F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: I123F

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173372
AA Change: I123F

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: I123F

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173426
Predicted Effect possibly damaging
Transcript: ENSMUST00000174695
AA Change: I93F

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134600
Gene: ENSMUSG00000024300
AA Change: I93F

DomainStartEndE-ValueType
Pfam:Myosin_head 47 98 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R8507:Myo1f UTSW 17 33598018 missense probably benign 0.09
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTAGAGTAGGGCTGGTGCTTAG -3'
(R):5'- CTCACAAAGCGGCTGGAATTGTTG -3'

Sequencing Primer
(F):5'- GCTGGTGCTTAGTAAACTTAGCAAC -3'
(R):5'- TCTTGGCATTGCCGAAAGC -3'
Posted On2013-11-08